Variant NM_000492.4:c.-8G>C


Variant details:
Name NM_000492.4:c.-8G>C
Protein name NP_000483.3:p.(=)
Genomic name (hg19) chr7:g.117120141G>C    UCSC    gnomAD
#Exon/intron UTR 5
Legacy Name 125G/C
Class non disease-causing
WT sequence GGCCCTAGCAGGGACCCCAGCGCCC G AGAGACCATGCAGAGGTCGCCTCTG
Mutant sequence GGCCCTAGCAGGGACCCCAGCGCCC C AGAGACCATGCAGAGGTCGCCTCTG






External sources:
dbSNP
rs1800501
Not found







10 individuals carrying this variant are reported in CFTR-NGS catalogue


65 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 65
Asymptomatic compound heterozygote 2
CF 24
CFTR-RD34
  • Bronchiectasis  4
  • CBAVD  12
  • CRS-NP  1
  • Other  10
  • Pancreatitis  7
Fetal bowel anomalies 1
Pending 1
Pending (NBS) 2
Pending non-CF 1



Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
Other 4582heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4625heterozygoteVUS3 - Trans
VUS3- Undef
Other 4315heterozygotevarying clinical consequence- Undef
Other 4292heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 5607heterozygoteVUS3- Undef
Other 2474heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 1184heterozygotevarying clinical consequence- Undef
CFTR-RD-causing- Undef
Other 1123heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 5201heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 4695heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF 3228heterozygoteCF-causing - Cis
varying clinical consequence - Trans
CF 3223heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 2975heterozygoteCF-causing - Cis
CF-causing - Trans
CF 2974heterozygoteCF-causing - Cis
CF-causing - Trans
CF 5067heterozygoteCF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CF 2828heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4553heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4231heterozygoteCF-causing - Cis
CF-causing - Trans
CF 5341heterozygoteVUS3- Undef
VUS3- Undef
CF-causing- Undef
CF 652heterozygoteCF-causing- Undef
CF-causing- Undef
CF 637heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 559heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 373heterozygoteCF-causing- Undef
CF-causing- Undef
CF 316heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 230heterozygoteCF-causing- Undef
CF-causing- Undef
CF 174heterozygoteCF-causing- Undef
CF-causing- Undef
CF 132heterozygoteCF-causing- Undef
VUS1- Undef
CF-causing- Undef
CF 4697heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2241heterozygoteVUS4- Undef
CF-causing- Undef
CF 1757heterozygoteCF-causing- Undef
VUS3- Undef
CF 1516heterozygoteCF-causing- Undef
VUS2- Undef
CF 1313heterozygoteVUS4- Undef
CF 1011heterozygoteCF-causing- Undef
CF-causing- Undef
CF 955heterozygoteCF-causing- Undef
CF-causing- Undef
CBAVD 5068heterozygoteCF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CBAVD 4663heterozygotevarying clinical consequence- Undef
VUS3- Undef
CF-causing- Undef
CBAVD 3267heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4552heterozygoteCF-causing- Undef
CBAVD 5945heterozygoteCF-causing- Undef
VUS3- Undef
CFTR-RD-causing- Undef
CBAVD 612heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 401heterozygoteCF-causing- Undef
CBAVD 397heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 396heterozygote
CBAVD 4707heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 746heterozygoteCFTR-RD-causing- Undef
CBAVD 2390heterozygoteCF-causing- Undef
Pending non-CF 753heterozygoteCF-causing- Undef
VUS3- Undef
Bronchiectasis 3240heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Bronchiectasis 4242heterozygoteCF-causing- Undef
Bronchiectasis 2424heterozygote
Bronchiectasis 2304heterozygoteCF-causing- Undef
Pancreatitis 3224heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
VUS2- Undef
VUS3- Undef
Pancreatitis 3016heterozygotevarying clinical consequence - Trans
Pancreatitis 4559heterozygoteCF-causing- Undef
VUS3- Undef
Pancreatitis 4766heterozygoteVUS3- Undef
Pancreatitis 2418heterozygoteVUS3- Undef
Pancreatitis 2325heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2324heterozygoteVUS3- Undef
Fetal bowel anomalies 2388heterozygoteCF-causing- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 3031heterozygotevarying clinical consequence - Cis
CF-causing - Trans
Asymptomatic compound heterozygote 4656heterozygoteVUS3- Undef
VUS2- Undef
VUS3- Undef
VUS3- Undef
Pending (NBS) 3042heterozygoteCF-causing - Cis
varying clinical consequence - Trans
Pending (NBS) 5769heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Pending 3049heterozygoteCF-causing- Undef
VUS3- Undef
CRS-NP 4276heterozygoteVUS3- Undef


Color code:   non disease-causing <   VUS1 <   VUS2 <   VUS3 <   VUS4 <   VUS5 <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare