Variant NM_000492.4:c.1519_1521del


Variant details:
Name NM_000492.4:c.1519_1521del
Protein name NP_000483.3:p.(Ile507del)
Genomic name (hg19) chr7:g.117199644_117199646del    UCSC    
#Exon/intron exon 11
Legacy Name ΔI507
Class disease-causing
Subclass CF-causing
WT sequence GCCTGGCACCATTAAAGAAAATATC ATC TTTGGTGTTTCCTATGATGAATATA
Mutant sequence GCCTGGCACCATTAAAGAAAATATC --- TTTGGTGTTTCCTATGATGAATATA






External sources:
dbSNP
rs121908745

Not found



Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Gregory et al, 1991 1712898


« ✓ » indicates the type of analysis performed and not the results





No patient found in CFTR-NGS catalogue


51 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 51
Asymptomatic compound heterozygote 2
CF 40
CFTR-RD8
  • Bronchiectasis  1
  • CBAVD  4
  • CRS-NP  1
  • Other  1
  • Pancreatitis  1
Pending (NBS) 1



Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 3383heterozygoteCF-causing - Trans
CF 3330heterozygoteCF-causing - Trans
CF 3153heterozygoteCF-causing - Trans
CF 3056heterozygoteCF-causing - Trans
CF 2810heterozygoteCF-causing - Trans
CF 2772heterozygoteCF-causing - Trans
CF 2181heterozygotevarying clinical consequence- Undef
CF 2155heterozygoteCF-causing - Trans
CF 1986heterozygoteCF-causing- Undef
CF 3433heterozygoteCF-causing - Trans
CF 3639heterozygoteCF-causing - Trans
CF 3674heterozygoteCF-causing - Trans
CF 4485heterozygotevarying clinical consequence - Trans
CF 4399heterozygoteCF-causing - Trans
CF 4395heterozygoteCF-causing - Trans
CF 4237heterozygoteCF-causing - Trans
CF 4144heterozygoteCF-causing - Trans
CF 4069heterozygoteCF-causing - Trans
CF 4013heterozygoteCF-causing - Trans
CF 3873heterozygoteCF-causing - Trans
CF 3757heterozygoteCF-causing- Undef
CF 5449heterozygoteCF-causing - Trans
CF 5285heterozygoteCFTR-RD-causing - Trans
CFTR-RD-causing - Trans
CFTR-RD-causing - Trans
CF 1787heterozygoteCF-causing - Trans
CF 1016heterozygoteCF-causing - Trans
CF 816heterozygoteCF-causing - Trans
CF 636heterozygoteCF-causing - Trans
CF 381heterozygotevarying clinical consequence - Trans
CF 153heterozygoteCF-causing - Trans
CF 148heterozygoteCF-causing - Trans
CF 141heterozygoteCF-causing - Trans
CF 137heterozygoteCF-causing - Trans
CF 1107heterozygoteCF-causing - Trans
CF 1707heterozygoteCF-causing- Undef
CF 1699heterozygotevarying clinical consequence- Undef
CF 1698heterozygotevarying clinical consequence- Undef
CF 1686heterozygoteCF-causing - Trans
CF 1608heterozygoteCF-causing- Undef
CF 1152heterozygoteCF-causing - Trans
CF 4688heterozygotevarying clinical consequence - Trans
CRS-NP 95heterozygotevarying clinical consequence- Undef
CBAVD 5129heterozygoteVUS5- Undef
CBAVD 1780heterozygotevarying clinical consequence- Undef
CBAVD 1748heterozygotevarying clinical consequence- Undef
CBAVD 1280heterozygoteCFTR-RD-causing- Undef
Asymptomatic compound heterozygote 3020heterozygotevarying clinical consequence - Trans
VUS1 - Trans
Asymptomatic compound heterozygote 1083heterozygoteVUS1 - Trans
Other 1134heterozygotevarying clinical consequence- Undef
Bronchiectasis 1761heterozygoteVUS1 - Trans
Pancreatitis 6191heterozygoteCFTR-RD-causing- Undef
Pending (NBS) 5237heterozygoteCFTR-RD-causing - Trans


Color code:   non disease-causing <   VUS1 <   VUS2 <   VUS3 <   VUS4 <   VUS5 <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare