Variant NM_000492.4:c.1521_1523del
Name | NM_000492.4:c.1521_1523del | ||||
Protein name | NP_000483.3:p.(Phe508del) | ||||
Genomic name (hg19) | chr7:g.117199646_117199648del UCSC | ||||
#Exon/intron | exon 11 | ||||
Legacy Name | ΔF508 | ||||
Class | disease-causing | ||||
Subclass | CF-causing | ||||
complex allele in 0.59% of patients associated with WT sequence |
CTGGCACCATTAAAGAAAATATCAT CTT TGGTGTTTCCTATGATGAATATAGA |
Mutant sequence |
CTGGCACCATTAAAGAAAATATCAT --- TGGTGTTTCCTATGATGAATATAGA |
|
dbSNP rs113993960 | Not found |
Modulator | FDA approval | EMA approval | in vitro / ex vivo data | clinical data |
IVA | no | no | no | no |
TEZ-IVA | yes | no | yes | no |
ELX-TEZ-IVA | yes | yes | no | yes |
clinical and functional data are provided by Vertex
49 individuals carrying this variant are reported in CFTR-NGS catalogue |
TOTAL NUMBER OF PATIENTS | 3885 |
---|---|
Asymptomatic compound heterozygote | 68 |
CF | 2672 |
CFTR-RD | 864
|
Fetal bowel anomalies | 58 |
Pending | 29 |
Pending (NBS) | 185 |
Pending non-CF | 9 |
Phenotype | Patient ID | Variant status | Additional variants |
---|---|---|---|
CF | 1 | heterozygote | CF-causing - Trans |
CF | 2 | heterozygote | CF-causing - Trans |
CF | 3 | heterozygote | CF-causing - Trans |
CF | 6 | heterozygote | CF-causing - Trans |
CF | 7 | heterozygote | CF-causing - Trans |
CF | 11 | heterozygote | CF-causing - Trans |
CF | 14 | heterozygote | CF-causing - Trans |
CF | 16 | heterozygote | CF-causing- Undef |
CF | 25 | heterozygote | varying clinical consequence - Trans |
CF | 32 | heterozygote | CF-causing - Trans |
CF | 33 | heterozygote | CF-causing - Trans |
CF | 36 | heterozygote | CF-causing - Trans |
CF | 37 | heterozygote | CF-causing - Trans |
CF | 39 | heterozygote | CF-causing - Trans |
CF | 41 | heterozygote | varying clinical consequence - Trans |
CF | 43 | heterozygote | CF-causing - Trans |
CF | 45 | heterozygote | CF-causing - Trans |
CF | 46 | heterozygote | CF-causing - Trans |
CF | 51 | heterozygote | CF-causing - Trans |
CF | 59 | heterozygote | varying clinical consequence- Undef |
CF | 61 | heterozygote | CF-causing - Trans |
CF | 62 | heterozygote | CF-causing - Trans |
CF | 63 | heterozygote | CF-causing - Trans |
CF | 69 | heterozygote | CF-causing - Trans |
CF | 73 | heterozygote | varying clinical consequence - Trans |
CF | 79 | heterozygote | CF-causing - Trans |
CF | 82 | heterozygote | CF-causing - Trans |
CF | 83 | heterozygote | CF-causing - Trans |
CF | 4700 | heterozygote | CF-causing - Trans |
CF | 4719 | heterozygote | varying clinical consequence - Trans |
CF | 4732 | heterozygote | varying clinical consequence - Trans |
CF | 86 | heterozygote | CF-causing - Trans |
CF | 4845 | heterozygote | CF-causing - Trans |
CF | 88 | heterozygote | CFTR-RD-causing - Trans CF-causing - Trans |
CF | 89 | heterozygote | CF-causing - Trans |
CF | 90 | heterozygote | varying clinical consequence - Trans |
CF | 91 | heterozygote | CF-causing - Trans |
CF | 92 | heterozygote | CF-causing - Trans |
CF | 94 | heterozygote | CF-causing - Trans |
CF | 96 | heterozygote | VUS2 - Cis CF-causing - Trans |
CF | 99 | heterozygote | CF-causing - Trans |
CF | 100 | heterozygote | CF-causing - Trans |
CF | 105 | heterozygote | CF-causing - Trans |
CF | 107 | heterozygote | CF-causing - Trans |
CF | 109 | heterozygote | CF-causing- Undef |
CF | 113 | heterozygote | CF-causing - Trans |
CF | 117 | heterozygote | CF-causing - Trans |
CF | 120 | heterozygote | CF-causing - Trans |
CF | 121 | heterozygote | CF-causing - Trans |
CF | 122 | heterozygote | CF-causing - Trans |
CF | 123 | heterozygote | CF-causing - Trans |
CF | 131 | heterozygote | VUS3 - Trans CF-causing - Trans |
CF | 132 | heterozygote | VUS1 - Cis CF-causing - Trans |
CF | 133 | heterozygote | CF-causing - Trans |
CF | 137 | heterozygote | CF-causing - Trans |
CF | 138 | heterozygote | CF-causing - Trans |
CF | 141 | heterozygote | CF-causing - Trans |
CF | 145 | heterozygote | CF-causing - Trans |
CF | 148 | heterozygote | CF-causing - Trans |
CF | 151 | heterozygote | CF-causing - Trans |
CF | 152 | heterozygote | CF-causing - Trans |
CF | 154 | heterozygote | CF-causing - Trans |
CF | 157 | heterozygote | CF-causing - Trans |
CF | 158 | heterozygote | CF-causing- Undef |
CF | 159 | heterozygote | varying clinical consequence - Trans |
CF | 160 | heterozygote | CF-causing - Trans |
CF | 161 | heterozygote | CF-causing - Trans |
CF | 162 | heterozygote | CF-causing - Trans |
CF | 163 | heterozygote | CF-causing - Trans |
CF | 164 | heterozygote | CF-causing - Trans |
CF | 165 | heterozygote | CF-causing - Trans |
CF | 166 | heterozygote | CF-causing- Undef |
CF | 167 | heterozygote | CF-causing- Undef |
CF | 170 | heterozygote | CF-causing- Undef |
CF | 171 | heterozygote | varying clinical consequence- Undef |
CF | 173 | heterozygote | CF-causing- Undef |
CF | 174 | heterozygote | CF-causing- Undef |
CF | 175 | heterozygote | CF-causing- Undef |
CF | 178 | heterozygote | VUS1 - Cis VUS1 - Cis CF-causing - Trans |
CF | 181 | heterozygote | CF-causing - Trans |
CF | 182 | heterozygote | CF-causing - Trans |
CF | 183 | heterozygote | CF-causing - Trans |
CF | 184 | heterozygote | CF-causing - Trans |
CF | 185 | heterozygote | CF-causing - Trans |
CF | 187 | heterozygote | VUS1- Undef CF-causing- Undef |
CF | 190 | heterozygote | CF-causing- Undef |
CF | 195 | heterozygote | CF-causing - Trans VUS1- Undef |
CF | 197 | heterozygote | varying clinical consequence- Undef |
CF | 198 | heterozygote | CF-causing- Undef |
CF | 200 | heterozygote | CF-causing - Trans |
CF | 201 | heterozygote | CF-causing- Undef |
CF | 202 | heterozygote | VUS1- Undef CF-causing- Undef |
CF | 203 | heterozygote | CF-causing - Trans |
CF | 206 | heterozygote | |
CF | 208 | heterozygote | CF-causing - Trans |
CF | 209 | heterozygote | CF-causing- Undef |
CF | 214 | heterozygote | varying clinical consequence- Undef |
CF | 215 | heterozygote | VUS4 - Trans |
CF | 216 | heterozygote | CF-causing - Trans |
CF | 217 | heterozygote | CF-causing - Trans |
CF | 218 | heterozygote | CF-causing- Undef |
CF | 219 | heterozygote | varying clinical consequence- Undef |
CF | 220 | heterozygote | varying clinical consequence- Undef |
CF | 221 | heterozygote | CF-causing- Undef |
CF | 222 | heterozygote | CF-causing- Undef |
CF | 223 | heterozygote | CF-causing - Trans |
CF | 224 | heterozygote | CF-causing - Trans |
CF | 225 | heterozygote | VUS4 - Trans |
CF | 227 | heterozygote | varying clinical consequence - Trans |
CF | 228 | heterozygote | varying clinical consequence - Trans |
CF | 229 | heterozygote | CF-causing- Undef |
CF | 231 | heterozygote | CF-causing - Trans |
CF | 232 | heterozygote | varying clinical consequence - Trans |
CF | 233 | heterozygote | varying clinical consequence - Trans |
CF | 234 | heterozygote | CF-causing- Undef |
CF | 5079 | heterozygote | CF-causing - Trans |
CF | 237 | heterozygote | CF-causing - Trans |
CF | 238 | heterozygote | varying clinical consequence - Trans |
CF | 239 | heterozygote | CF-causing - Trans |
CF | 240 | heterozygote | CF-causing- Undef |
CF | 245 | heterozygote | VUS1 - Cis VUS1 - Cis CF-causing - Trans |
CF | 248 | heterozygote | CF-causing - Trans |
CF | 249 | heterozygote | varying clinical consequence - Trans |
CF | 252 | heterozygote | CF-causing- Undef |
CF | 254 | heterozygote | CF-causing- Undef |
CF | 255 | heterozygote | CF-causing - Trans |
CF | 257 | heterozygote | varying clinical consequence - Trans |
CF | 262 | heterozygote | varying clinical consequence - Trans |
CF | 264 | heterozygote | varying clinical consequence- Undef |
CF | 265 | heterozygote | CF-causing- Undef |
CF | 266 | heterozygote | CF-causing - Trans |
CF | 270 | heterozygote | CF-causing - Trans |
CF | 271 | heterozygote | CF-causing - Trans |
CF | 272 | heterozygote | CF-causing- Undef |
CF | 274 | heterozygote | CF-causing - Trans |
CF | 276 | heterozygote | CF-causing - Trans |
CF | 277 | heterozygote | varying clinical consequence- Undef |
CF | 280 | heterozygote | varying clinical consequence - Trans |
CF | 281 | heterozygote | CF-causing - Trans |
CF | 283 | heterozygote | CF-causing- Undef |
CF | 285 | heterozygote | CF-causing- Undef |
CF | 287 | heterozygote | CF-causing- Undef |
CF | 288 | heterozygote | CF-causing- Undef |
CF | 290 | heterozygote | CF-causing- Undef |
CF | 291 | heterozygote | CF-causing- Undef |
CF | 292 | heterozygote | CF-causing - Trans |
CF | 293 | heterozygote | CF-causing - Trans |
CF | 304 | heterozygote | VUS1 - Cis CF-causing - Trans |
CF | 306 | heterozygote | CF-causing - Trans |
CF | 307 | heterozygote | CF-causing - Trans |
CF | 308 | heterozygote | CF-causing - Trans |
CF | 309 | heterozygote | CF-causing - Trans |
CF | 310 | heterozygote | CF-causing - Trans |
CF | 313 | heterozygote | CFTR-RD-causing - Trans varying clinical consequence- Undef |
CF | 317 | heterozygote | CF-causing - Trans |
CF | 318 | heterozygote | CF-causing- Undef |
CF | 319 | heterozygote | CF-causing - Trans |
CF | 320 | heterozygote | CF-causing- Undef |
CF | 321 | heterozygote | varying clinical consequence- Undef |
CF | 326 | heterozygote | varying clinical consequence- Undef |
CF | 328 | heterozygote | CF-causing- Undef |
CF | 331 | heterozygote | CF-causing - Trans |
CF | 332 | heterozygote | CF-causing - Trans |
CF | 333 | heterozygote | varying clinical consequence - Trans |
CF | 334 | heterozygote | CF-causing - Trans |
CF | 336 | heterozygote | CF-causing - Trans |
CF | 338 | heterozygote | VUS5 - Trans |
CF | 340 | heterozygote | VUS1 - Trans CF-causing - Trans |
CF | 346 | heterozygote | CF-causing - Trans |
CF | 347 | heterozygote | varying clinical consequence - Trans |
CF | 350 | heterozygote | CF-causing- Undef |
CF | 353 | heterozygote | CF-causing - Trans |
CF | 355 | heterozygote | CF-causing - Trans |
CF | 356 | heterozygote | CF-causing - Trans |
CF | 357 | heterozygote | CF-causing - Trans |
CF | 359 | heterozygote | VUS1 - Cis CF-causing - Trans |
CF | 361 | heterozygote | CF-causing - Trans |
CF | 363 | heterozygote | CF-causing - Trans |
CF | 369 | heterozygote | varying clinical consequence- Undef |
CF | 373 | heterozygote | CF-causing - Trans |
CF | 374 | heterozygote | CFTR-RD-causing - Trans |
CF | 380 | heterozygote | CF-causing- Undef |
CF | 382 | heterozygote | VUS3 - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
CF | 384 | heterozygote | CF-causing - Trans |
CF | 386 | heterozygote | CF-causing - Trans |
CF | 390 | heterozygote | CF-causing - Trans |
CF | 466 | heterozygote | CF-causing - Trans VUS1- Undef |
CF | 502 | heterozygote | CF-causing- Undef |
CF | 509 | heterozygote | CF-causing - Trans |
CF | 559 | heterozygote | varying clinical consequence - Trans |
CF | 564 | heterozygote | CF-causing - Trans |
CF | 567 | heterozygote | CF-causing - Trans |
CF | 576 | heterozygote | CF-causing - Trans |
CF | 588 | heterozygote | CF-causing - Trans |
CF | 600 | heterozygote | varying clinical consequence- Undef |
CF | 601 | heterozygote | CF-causing- Undef |
CF | 602 | heterozygote | CF-causing - Trans |
CF | 604 | heterozygote | CF-causing - Trans |
CF | 611 | heterozygote | CF-causing - Trans |
CF | 616 | heterozygote | CF-causing - Trans |
CF | 620 | heterozygote | CF-causing - Trans |
CF | 622 | heterozygote | varying clinical consequence - Trans |
CF | 623 | heterozygote | varying clinical consequence - Trans |
CF | 641 | heterozygote | CF-causing - Trans |
CF | 649 | heterozygote | CF-causing - Trans |
CF | 651 | heterozygote | CF-causing - Trans |
CF | 654 | heterozygote | CF-causing- Undef |
CF | 657 | heterozygote | CF-causing - Trans |
CF | 661 | heterozygote | CF-causing - Trans |
CF | 662 | heterozygote | VUS2 - Cis varying clinical consequence - Trans |
CF | 663 | heterozygote | VUS2 - Cis varying clinical consequence - Trans |
CF | 666 | heterozygote | CF-causing - Trans VUS3 - Trans |
CF | 668 | heterozygote | CF-causing - Trans |
CF | 671 | heterozygote | CF-causing- Undef |
CF | 672 | heterozygote | CF-causing - Trans |
CF | 681 | heterozygote | CF-causing - Trans |
CF | 683 | heterozygote | CF-causing - Trans |
CF | 684 | heterozygote | CF-causing- Undef |
CF | 688 | heterozygote | CF-causing - Trans |
CF | 691 | heterozygote | CF-causing - Trans |
CF | 695 | heterozygote | CF-causing - Trans |
CF | 696 | heterozygote | CFTR-RD-causing - Trans CF-causing - Trans |
CF | 702 | heterozygote | CF-causing - Trans |
CF | 703 | heterozygote | CF-causing - Trans |
CF | 704 | heterozygote | CF-causing - Trans |
CF | 706 | heterozygote | CF-causing - Trans |
CF | 711 | heterozygote | CF-causing - Trans |
CF | 714 | heterozygote | CF-causing - Trans |
CF | 715 | heterozygote | CF-causing - Trans |
CF | 716 | heterozygote | VUS1- Undef CF-causing- Undef |
CF | 723 | heterozygote | CF-causing - Trans |
CF | 731 | heterozygote | CF-causing - Trans |
CF | 732 | heterozygote | CF-causing - Trans |
CF | 733 | heterozygote | VUS3- Undef |
CF | 738 | heterozygote | CF-causing - Trans |
CF | 742 | heterozygote | varying clinical consequence- Undef |
CF | 745 | heterozygote | CF-causing - Trans |
CF | 747 | heterozygote | CF-causing - Trans |
CF | 758 | heterozygote | CF-causing - Trans |
CF | 761 | heterozygote | CF-causing - Trans |
CF | 762 | heterozygote | CF-causing- Undef |
CF | 773 | heterozygote | CF-causing - Trans |
CF | 783 | heterozygote | varying clinical consequence - Trans |
CF | 5084 | heterozygote | VUS3 - Trans |
CF | 787 | heterozygote | varying clinical consequence - Trans |
CF | 795 | heterozygote | CF-causing - Trans |
CF | 800 | heterozygote | CF-causing - Trans |
CF | 813 | heterozygote | varying clinical consequence - Trans |
CF | 814 | heterozygote | CF-causing - Trans |
CF | 820 | heterozygote | CF-causing - Trans |
CF | 821 | heterozygote | varying clinical consequence - Trans |
CF | 822 | heterozygote | varying clinical consequence - Trans |
CF | 835 | heterozygote | CF-causing - Trans |
CF | 836 | heterozygote | CF-causing - Trans |
CF | 842 | heterozygote | CF-causing- Undef |
CF | 843 | heterozygote | CF-causing - Trans |
CF | 844 | heterozygote | CF-causing- Undef |
CF | 846 | heterozygote | CF-causing - Trans |
CF | 848 | heterozygote | CF-causing - Trans |
CF | 860 | heterozygote | VUS1 - Cis CF-causing - Trans |
CF | 863 | heterozygote | CF-causing - Trans |
CF | 867 | heterozygote | CF-causing - Trans |
CF | 872 | heterozygote | CF-causing - Trans |
CF | 878 | heterozygote | CF-causing - Trans |
CF | 882 | heterozygote | VUS4- Undef |
CF | 884 | heterozygote | CF-causing - Trans |
CF | 889 | heterozygote | CF-causing - Trans |
CF | 906 | heterozygote | CF-causing - Trans |
CF | 913 | heterozygote | varying clinical consequence- Undef |
CF | 920 | heterozygote | VUS2- Undef CF-causing- Undef |
CF | 924 | heterozygote | CF-causing - Trans |
CF | 926 | heterozygote | varying clinical consequence - Trans |
CF | 928 | heterozygote | CF-causing - Trans |
CF | 929 | heterozygote | CF-causing - Trans |
CF | 943 | heterozygote | varying clinical consequence - Trans |
CF | 945 | heterozygote | CF-causing- Undef |
CF | 947 | heterozygote | varying clinical consequence- Undef |
CF | 952 | heterozygote | varying clinical consequence - Trans |
CF | 953 | heterozygote | CF-causing - Trans |
CF | 954 | heterozygote | CF-causing - Trans |
CF | 955 | heterozygote | CF-causing - Trans |
CF | 956 | heterozygote | CF-causing - Trans |
CF | 957 | heterozygote | CF-causing - Trans |
CF | 960 | heterozygote | CF-causing - Trans |
CF | 968 | heterozygote | CF-causing - Trans |
CF | 969 | heterozygote | CF-causing - Trans |
CF | 970 | heterozygote | CF-causing - Trans |
CF | 973 | heterozygote | CF-causing- Undef |
CF | 984 | heterozygote | CF-causing - Trans |
CF | 985 | heterozygote | CF-causing - Trans |
CF | 989 | heterozygote | CF-causing- Undef |
CF | 994 | heterozygote | CF-causing - Trans |
CF | 997 | heterozygote | varying clinical consequence - Trans |
CF | 1000 | heterozygote | CF-causing - Trans |
CF | 1002 | heterozygote | varying clinical consequence - Trans |
CF | 1005 | heterozygote | CF-causing - Trans |
CF | 1006 | heterozygote | CF-causing - Trans |
CF | 1007 | heterozygote | CF-causing - Trans |
CF | 1010 | heterozygote | CF-causing - Trans |
CF | 4822 | heterozygote | CF-causing - Trans |
CF | 4823 | heterozygote | CF-causing - Trans |
CF | 1012 | heterozygote | CF-causing - Trans |
CF | 4831 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
CF | 4832 | heterozygote | CF-causing- Undef |
CF | 5143 | heterozygote | CF-causing- Undef |
CF | 5227 | heterozygote | CF-causing - Trans |
CF | 5135 | heterozygote | CF-causing - Trans |
CF | 5178 | heterozygote | CF-causing- Undef |
CF | 5256 | heterozygote | VUS3- Undef VUS2- Undef |
CF | 5534 | heterozygote | CF-causing - Trans |
CF | 5148 | heterozygote | CF-causing - Trans |
CF | 5746 | heterozygote | CF-causing - Trans |
CF | 1014 | heterozygote | CF-causing - Trans |
CF | 1016 | heterozygote | CF-causing - Trans |
CF | 1018 | heterozygote | VUS3 - Trans |
CF | 1019 | heterozygote | varying clinical consequence- Undef |
CF | 1021 | heterozygote | CF-causing - Trans |
CF | 1022 | heterozygote | CF-causing - Trans |
CF | 1026 | heterozygote | CF-causing - Trans |
CF | 1027 | heterozygote | CF-causing - Trans |
CF | 4775 | heterozygote | CF-causing- Undef |
CF | 4778 | heterozygote | varying clinical consequence - Trans |
CF | 1031 | heterozygote | CF-causing - Trans |
CF | 4781 | heterozygote | CF-causing - Trans VUS1- Undef |
CF | 4782 | heterozygote | varying clinical consequence - Trans |
CF | 4784 | heterozygote | CF-causing- Undef |
CF | 1041 | heterozygote | CF-causing - Trans |
CF | 4785 | heterozygote | varying clinical consequence- Undef |
CF | 1042 | heterozygote | CFTR-RD-causing - Trans CF-causing- Undef |
CF | 1045 | heterozygote | CF-causing - Trans |
CF | 1047 | heterozygote | CF-causing - Trans |
CF | 4788 | heterozygote | varying clinical consequence - Trans |
CF | 4791 | heterozygote | CF-causing - Trans VUS3- Undef |
CF | 4793 | heterozygote | CF-causing- Undef |
CF | 4797 | heterozygote | CF-causing - Trans |
CF | 5185 | heterozygote | CF-causing - Trans VUS3- Undef |
CF | 5186 | heterozygote | varying clinical consequence - Trans VUS3- Undef |
CF | 1071 | heterozygote | varying clinical consequence - Trans |
CF | 5189 | heterozygote | varying clinical consequence - Trans VUS3- Undef |
CF | 1085 | heterozygote | CF-causing - Trans |
CF | 1086 | heterozygote | CF-causing- Undef |
CF | 1092 | heterozygote | CF-causing- Undef |
CF | 1093 | heterozygote | CF-causing - Trans |
CF | 1095 | heterozygote | CF-causing - Trans |
CF | 1100 | heterozygote | CF-causing - Trans |
CF | 1101 | heterozygote | CF-causing - Trans VUS3- Undef |
CF | 1107 | heterozygote | CF-causing - Trans |
CF | 1119 | heterozygote | CF-causing- Undef |
CF | 1121 | heterozygote | CF-causing - Trans |
CF | 1125 | heterozygote | CF-causing - Trans |
CF | 1133 | heterozygote | CF-causing - Trans |
CF | 1137 | heterozygote | CF-causing - Trans VUS1 - Trans |
CF | 1139 | heterozygote | CF-causing - Trans |
CF | 1140 | heterozygote | CF-causing - Trans |
CF | 1142 | heterozygote | CF-causing - Trans |
CF | 1146 | heterozygote | CF-causing - Trans |
CF | 1148 | heterozygote | CF-causing - Trans |
CF | 1151 | heterozygote | VUS4- Undef |
CF | 1152 | heterozygote | CF-causing - Trans |
CF | 1153 | heterozygote | CF-causing - Trans |
CF | 1157 | heterozygote | CF-causing - Trans |
CF | 1159 | heterozygote | CF-causing - Trans |
CF | 1160 | heterozygote | CF-causing - Trans |
CF | 1165 | heterozygote | CF-causing - Trans |
CF | 1166 | heterozygote | CF-causing- Undef |
CF | 1172 | heterozygote | CF-causing - Trans |
CF | 1173 | heterozygote | CF-causing - Trans |
CF | 1178 | heterozygote | CF-causing - Trans |
CF | 1186 | heterozygote | CF-causing - Trans |
CF | 1187 | heterozygote | CF-causing - Trans |
CF | 1190 | heterozygote | CF-causing - Trans |
CF | 1191 | heterozygote | CF-causing - Trans |
CF | 1192 | heterozygote | CF-causing - Trans |
CF | 1193 | heterozygote | CF-causing - Trans |
CF | 1205 | heterozygote | |
CF | 1223 | heterozygote | CF-causing - Trans |
CF | 1226 | heterozygote | CF-causing- Undef |
CF | 1227 | heterozygote | CF-causing - Trans |
CF | 1228 | heterozygote | CF-causing - Trans |
CF | 1232 | heterozygote | varying clinical consequence- Undef |
CF | 1233 | heterozygote | varying clinical consequence- Undef |
CF | 1238 | heterozygote | varying clinical consequence - Trans |
CF | 1241 | heterozygote | CF-causing- Undef |
CF | 1258 | heterozygote | CF-causing - Trans |
CF | 1259 | heterozygote | varying clinical consequence- Undef |
CF | 1266 | heterozygote | CF-causing - Trans |
CF | 1273 | heterozygote | varying clinical consequence - Trans |
CF | 1278 | heterozygote | CF-causing- Undef |
CF | 1279 | heterozygote | varying clinical consequence - Trans |
CF | 1299 | heterozygote | CF-causing- Undef |
CF | 1300 | heterozygote | |
CF | 1303 | heterozygote | CF-causing- Undef |
CF | 1304 | heterozygote | CF-causing- Undef |
CF | 1306 | heterozygote | CF-causing - Trans |
CF | 1309 | heterozygote | varying clinical consequence- Undef |
CF | 1310 | heterozygote | varying clinical consequence- Undef |
CF | 1311 | heterozygote | varying clinical consequence - Trans |
CF | 1315 | heterozygote | CF-causing - Trans |
CF | 4847 | heterozygote | varying clinical consequence- Undef |
CF | 4853 | heterozygote | CF-causing - Trans |
CF | 4865 | heterozygote | varying clinical consequence- Undef |
CF | 4862 | heterozygote | varying clinical consequence- Undef |
CF | 4864 | heterozygote | varying clinical consequence- Undef |
CF | 4858 | heterozygote | varying clinical consequence- Undef |
CF | 4855 | heterozygote | VUS3- Undef |
CF | 4860 | heterozygote | varying clinical consequence- Undef |
CF | 4856 | heterozygote | CF-causing- Undef |
CF | 4854 | heterozygote | CF-causing - Trans |
CF | 4859 | heterozygote | CF-causing - Trans |
CF | 4861 | heterozygote | VUS3 - Trans VUS3 - Trans |
CF | 4872 | heterozygote | CF-causing- Undef |
CF | 4871 | heterozygote | varying clinical consequence - Trans |
CF | 1440 | heterozygote | varying clinical consequence- Undef |
CF | 1515 | heterozygote | CF-causing - Trans |
CF | 1516 | heterozygote | VUS2- Undef |
CF | 1518 | heterozygote | VUS5 - Trans |
CF | 1520 | heterozygote | CF-causing - Trans |
CF | 1526 | heterozygote | CF-causing - Trans |
CF | 1527 | heterozygote | CFTR-RD-causing - Trans |
CF | 1531 | heterozygote | CF-causing - Trans |
CF | 1532 | heterozygote | CF-causing- Undef |
CF | 1533 | heterozygote | CF-causing - Trans |
CF | 1536 | heterozygote | CF-causing- Undef |
CF | 1538 | heterozygote | CF-causing - Trans |
CF | 1539 | heterozygote | |
CF | 1540 | heterozygote | varying clinical consequence- Undef |
CF | 1541 | heterozygote | varying clinical consequence- Undef |
CF | 1543 | heterozygote | varying clinical consequence- Undef |
CF | 1545 | heterozygote | varying clinical consequence - Trans |
CF | 1546 | heterozygote | |
CF | 1549 | heterozygote | CFTR-RD-causing - Trans CF-causing - Trans |
CF | 1550 | heterozygote | CF-causing - Trans |
CF | 1553 | heterozygote | CF-causing - Trans |
CF | 1556 | heterozygote | CF-causing - Trans |
CF | 1559 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CF-causing- Undef |
CF | 1562 | heterozygote | CFTR-RD-causing - Trans |
CF | 1567 | heterozygote | CF-causing - Trans |
CF | 1570 | heterozygote | varying clinical consequence - Trans |
CF | 1571 | heterozygote | CFTR-RD-causing - Trans |
CF | 1572 | heterozygote | CF-causing - Trans |
CF | 1573 | heterozygote | CF-causing - Trans |
CF | 1577 | heterozygote | CF-causing - Trans |
CF | 1578 | heterozygote | CF-causing - Trans |
CF | 1579 | heterozygote | CF-causing- Undef |
CF | 1581 | heterozygote | CF-causing - Trans |
CF | 1583 | heterozygote | CF-causing - Trans |
CF | 1584 | heterozygote | CF-causing - Trans |
CF | 1585 | heterozygote | CF-causing- Undef |
CF | 5434 | heterozygote | VUS3 - Trans |
CF | 5507 | heterozygote | VUS2 - Trans |
CF | 5713 | heterozygote | VUS3- Undef |
CF | 1589 | heterozygote | CF-causing- Undef |
CF | 1593 | heterozygote | CF-causing- Undef |
CF | 1596 | heterozygote | CF-causing- Undef |
CF | 1598 | heterozygote | CF-causing- Undef |
CF | 1600 | heterozygote | CF-causing- Undef |
CF | 1604 | heterozygote | CF-causing- Undef |
CF | 1605 | heterozygote | CF-causing- Undef |
CF | 1610 | heterozygote | varying clinical consequence- Undef |
CF | 1612 | heterozygote | CF-causing- Undef |
CF | 1614 | heterozygote | CF-causing- Undef |
CF | 1629 | heterozygote | CF-causing- Undef |
CF | 1638 | heterozygote | CF-causing- Undef |
CF | 1642 | heterozygote | CF-causing- Undef |
CF | 1653 | heterozygote | CF-causing- Undef |
CF | 1654 | heterozygote | CF-causing- Undef |
CF | 1657 | heterozygote | CF-causing- Undef |
CF | 1658 | heterozygote | varying clinical consequence- Undef |
CF | 1665 | heterozygote | CF-causing- Undef |
CF | 1666 | heterozygote | CF-causing- Undef |
CF | 1667 | heterozygote | varying clinical consequence- Undef |
CF | 1677 | heterozygote | CF-causing- Undef |
CF | 1678 | heterozygote | CF-causing- Undef |
CF | 1683 | heterozygote | CF-causing- Undef |
CF | 1684 | heterozygote | CF-causing- Undef |
CF | 1685 | heterozygote | CF-causing- Undef |
CF | 1686 | heterozygote | CF-causing - Trans |
CF | 1689 | heterozygote | CF-causing- Undef |
CF | 1690 | heterozygote | CF-causing- Undef |
CF | 1692 | heterozygote | CF-causing- Undef |
CF | 1693 | heterozygote | varying clinical consequence- Undef |
CF | 1697 | heterozygote | CF-causing- Undef |
CF | 1700 | heterozygote | CF-causing- Undef |
CF | 1701 | heterozygote | CF-causing- Undef |
CF | 1702 | heterozygote | varying clinical consequence- Undef |
CF | 1704 | heterozygote | CF-causing- Undef |
CF | 1707 | heterozygote | CF-causing- Undef |
CF | 1710 | heterozygote | CF-causing- Undef |
CF | 1714 | heterozygote | CF-causing- Undef |
CF | 1717 | heterozygote | CF-causing- Undef |
CF | 1718 | heterozygote | varying clinical consequence- Undef |
CF | 1736 | heterozygote | CF-causing- Undef |
CF | 1737 | heterozygote | CF-causing- Undef |
CF | 1738 | heterozygote | CF-causing- Undef |
CF | 1740 | heterozygote | CF-causing- Undef |
CF | 1743 | heterozygote | varying clinical consequence- Undef |
CF | 1744 | heterozygote | CF-causing- Undef |
CF | 1749 | heterozygote | CF-causing- Undef |
CF | 1753 | heterozygote | CF-causing- Undef |
CF | 1757 | heterozygote | VUS3- Undef |
CF | 1758 | heterozygote | VUS3- Undef |
CF | 1760 | heterozygote | CF-causing- Undef |
CF | 1762 | heterozygote | CF-causing- Undef |
CF | 1770 | heterozygote | CF-causing- Undef |
CF | 1771 | heterozygote | varying clinical consequence- Undef |
CF | 1775 | heterozygote | CF-causing- Undef |
CF | 1778 | heterozygote | CF-causing- Undef |
CF | 1779 | heterozygote | CF-causing- Undef |
CF | 1782 | heterozygote | CF-causing- Undef |
CF | 1787 | heterozygote | CF-causing - Trans |
CF | 1788 | heterozygote | CF-causing- Undef |
CF | 1789 | heterozygote | CF-causing- Undef |
CF | 1790 | heterozygote | CF-causing- Undef |
CF | 4968 | heterozygote | CFTR-RD-causing - Trans |
CF | 4970 | heterozygote | varying clinical consequence - Trans |
CF | 4973 | heterozygote | CFTR-RD-causing- Undef |
CF | 4983 | heterozygote | CF-causing- Undef |
CF | 4985 | heterozygote | CF-causing- Undef |
CF | 4986 | heterozygote | CF-causing- Undef |
CF | 5468 | heterozygote | VUS3 - Trans |
CF | 5899 | heterozygote | varying clinical consequence- Undef |
CF | 4995 | heterozygote | VUS1 - Cis VUS1 - Cis VUS3 - Trans |
CF | 4999 | heterozygote | varying clinical consequence- Undef |
CF | 1800 | heterozygote | varying clinical consequence- Undef |
CF | 1807 | heterozygote | varying clinical consequence- Undef |
CF | 1814 | heterozygote | CF-causing- Undef |
CF | 5023 | heterozygote | CF-causing- Undef |
CF | 5027 | heterozygote | VUS3- Undef |
CF | 5033 | heterozygote | CF-causing- Undef |
CF | 5469 | heterozygote | varying clinical consequence- Undef |
CF | 5036 | heterozygote | CF-causing- Undef |
CF | 5038 | heterozygote | VUS3- Undef |
CF | 5040 | heterozygote | CFTR-RD-causing- Undef |
CF | 5041 | heterozygote | varying clinical consequence- Undef |
CF | 2234 | heterozygote | CF-causing- Undef |
CF | 5045 | heterozygote | CF-causing- Undef |
CF | 5053 | heterozygote | VUS3- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CF | 5057 | heterozygote | CF-causing- Undef |
CF | 1819 | heterozygote | varying clinical consequence- Undef |
CF | 1822 | heterozygote | CF-causing- Undef |
CF | 1824 | heterozygote | CF-causing- Undef |
CF | 1826 | heterozygote | CF-causing- Undef |
CF | 1834 | heterozygote | CF-causing- Undef |
CF | 1837 | heterozygote | CF-causing- Undef |
CF | 1838 | heterozygote | CF-causing- Undef |
CF | 1839 | heterozygote | CF-causing- Undef |
CF | 1842 | heterozygote | CF-causing- Undef |
CF | 1849 | heterozygote | CF-causing- Undef |
CF | 1852 | heterozygote | CF-causing- Undef |
CF | 1854 | heterozygote | VUS4- Undef |
CF | 1857 | heterozygote | CF-causing- Undef |
CF | 5284 | heterozygote | varying clinical consequence- Undef |
CF | 5098 | heterozygote | CF-causing- Undef |
CF | 5292 | heterozygote | CF-causing - Trans |
CF | 5101 | heterozygote | CF-causing - Trans |
CF | 5300 | heterozygote | CF-causing- Undef |
CF | 5104 | heterozygote | VUS5 - Trans |
CF | 5105 | heterozygote | CFTR-RD-causing- Undef |
CF | 5107 | heterozygote | CF-causing - Trans |
CF | 5114 | heterozygote | CF-causing- Undef |
CF | 1859 | heterozygote | CF-causing- Undef |
CF | 1861 | heterozygote | CF-causing- Undef |
CF | 1863 | heterozygote | CF-causing- Undef VUS1- Undef |
CF | 1867 | heterozygote | varying clinical consequence- Undef |
CF | 1873 | heterozygote | CF-causing- Undef |
CF | 1877 | heterozygote | CF-causing- Undef |
CF | 1881 | heterozygote | CF-causing- Undef |
CF | 1883 | heterozygote | CF-causing- Undef |
CF | 1884 | heterozygote | varying clinical consequence- Undef |
CF | 1885 | heterozygote | CF-causing- Undef |
CF | 1886 | heterozygote | CF-causing- Undef |
CF | 1888 | heterozygote | VUS4- Undef |
CF | 5367 | heterozygote | VUS3 - Trans |
CF | 1889 | heterozygote | CF-causing- Undef |
CF | 1890 | heterozygote | CF-causing- Undef |
CF | 1894 | heterozygote | varying clinical consequence - Trans |
CF | 1896 | heterozygote | CF-causing- Undef |
CF | 1897 | heterozygote | CF-causing- Undef |
CF | 1898 | heterozygote | CF-causing- Undef |
CF | 1903 | heterozygote | CF-causing- Undef |
CF | 1909 | heterozygote | CF-causing- Undef |
CF | 1913 | heterozygote | CF-causing- Undef |
CF | 1916 | heterozygote | CF-causing- Undef |
CF | 1918 | heterozygote | CF-causing- Undef |
CF | 5370 | heterozygote | CF-causing- Undef |
CF | 5374 | heterozygote | VUS3 - Trans VUS1 - Trans CF-causing - Trans |
CF | 5384 | heterozygote | CF-causing - Trans |
CF | 5389 | heterozygote | CF-causing- Undef |
CF | 5390 | heterozygote | CF-causing- Undef |
CF | 5391 | heterozygote | CFTR-RD-causing- Undef |
CF | 5440 | heterozygote | CF-causing- Undef |
CF | 5441 | heterozygote | CF-causing - Trans |
CF | 5448 | heterozygote | CF-causing- Undef |
CF | 5462 | heterozygote | VUS3- Undef |
CF | 5670 | heterozygote | VUS3 - Trans |
CF | 5674 | heterozygote | CF-causing - Trans |
CF | 5676 | heterozygote | CF-causing - Trans |
CF | 5699 | heterozygote | varying clinical consequence- Undef |
CF | 5861 | heterozygote | CF-causing- Undef |
CF | 5863 | heterozygote | varying clinical consequence- Undef |
CF | 5876 | heterozygote | VUS3- Undef |
CF | 5880 | heterozygote | CF-causing- Undef |
CF | 5885 | heterozygote | CF-causing - Trans |
CF | 5886 | heterozygote | VUS3- Undef |
CF | 5893 | heterozygote | CF-causing - Trans |
CF | 1927 | heterozygote | CF-causing- Undef |
CF | 1928 | heterozygote | CF-causing- Undef |
CF | 1929 | heterozygote | CF-causing- Undef |
CF | 1931 | heterozygote | CF-causing- Undef |
CF | 1932 | heterozygote | CF-causing- Undef |
CF | 1933 | heterozygote | CF-causing- Undef |
CF | 1934 | heterozygote | CF-causing- Undef |
CF | 1936 | heterozygote | CF-causing- Undef |
CF | 1939 | heterozygote | CF-causing- Undef |
CF | 1943 | heterozygote | CF-causing - Trans |
CF | 1944 | heterozygote | CF-causing- Undef |
CF | 1948 | heterozygote | CF-causing - Trans VUS1 - Trans |
CF | 1956 | heterozygote | varying clinical consequence- Undef |
CF | 1958 | heterozygote | CF-causing- Undef |
CF | 1959 | heterozygote | CF-causing- Undef |
CF | 1964 | heterozygote | CFTR-RD-causing - Trans |
CF | 1965 | heterozygote | CF-causing- Undef |
CF | 1966 | heterozygote | varying clinical consequence- Undef |
CF | 1970 | heterozygote | varying clinical consequence- Undef |
CF | 1973 | heterozygote | CF-causing- Undef |
CF | 1974 | heterozygote | CF-causing- Undef |
CF | 1976 | heterozygote | CF-causing- Undef |
CF | 1978 | heterozygote | CF-causing- Undef |
CF | 1986 | heterozygote | CF-causing- Undef |
CF | 1987 | heterozygote | CF-causing- Undef |
CF | 1991 | heterozygote | CF-causing- Undef |
CF | 1994 | heterozygote | CF-causing- Undef |
CF | 1995 | heterozygote | CF-causing- Undef |
CF | 1997 | heterozygote | CF-causing- Undef |
CF | 1998 | heterozygote | CF-causing- Undef |
CF | 2001 | heterozygote | CF-causing- Undef |
CF | 2008 | heterozygote | CF-causing- Undef |
CF | 2013 | heterozygote | varying clinical consequence- Undef |
CF | 2016 | heterozygote | varying clinical consequence- Undef |
CF | 2023 | heterozygote | varying clinical consequence- Undef |
CF | 2035 | heterozygote | CF-causing- Undef |
CF | 2045 | heterozygote | VUS3- Undef |
CF | 2046 | heterozygote | CF-causing- Undef |
CF | 2048 | heterozygote | CF-causing- Undef |
CF | 2050 | heterozygote | varying clinical consequence- Undef |
CF | 2051 | heterozygote | CF-causing- Undef |
CF | 2052 | heterozygote | CF-causing- Undef |
CF | 2053 | heterozygote | CF-causing- Undef VUS1- Undef |
CF | 2056 | heterozygote | CF-causing- Undef |
CF | 2062 | heterozygote | CF-causing- Undef |
CF | 2066 | heterozygote | CF-causing- Undef |
CF | 2072 | heterozygote | varying clinical consequence- Undef |
CF | 2076 | heterozygote | CF-causing- Undef |
CF | 2077 | heterozygote | varying clinical consequence- Undef |
CF | 2081 | heterozygote | CF-causing- Undef |
CF | 2082 | heterozygote | CF-causing- Undef |
CF | 2083 | heterozygote | CF-causing- Undef |
CF | 2088 | heterozygote | varying clinical consequence- Undef |
CF | 2089 | heterozygote | CF-causing- Undef |
CF | 2094 | heterozygote | CF-causing- Undef |
CF | 2097 | heterozygote | CF-causing- Undef |
CF | 2105 | heterozygote | CF-causing- Undef |
CF | 2111 | heterozygote | CF-causing- Undef |
CF | 2112 | heterozygote | CF-causing- Undef |
CF | 2121 | heterozygote | varying clinical consequence- Undef |
CF | 2122 | heterozygote | CF-causing- Undef |
CF | 2124 | heterozygote | CF-causing- Undef |
CF | 2126 | heterozygote | CF-causing- Undef |
CF | 2128 | heterozygote | CF-causing- Undef |
CF | 2129 | heterozygote | CF-causing- Undef |
CF | 2131 | heterozygote | varying clinical consequence- Undef |
CF | 2146 | heterozygote | CF-causing- Undef |
CF | 2148 | heterozygote | CF-causing- Undef |
CF | 2153 | heterozygote | VUS3- Undef |
CF | 2155 | heterozygote | CF-causing - Trans |
CF | 2158 | heterozygote | CF-causing- Undef |
CF | 2172 | heterozygote | CF-causing- Undef |
CF | 2175 | heterozygote | varying clinical consequence- Undef |
CF | 2176 | heterozygote | CF-causing- Undef |
CF | 2177 | heterozygote | CF-causing- Undef |
CF | 2179 | heterozygote | CF-causing- Undef |
CF | 2182 | heterozygote | CFTR-RD-causing- Undef |
CF | 2191 | heterozygote | CF-causing- Undef |
CF | 2192 | heterozygote | CF-causing- Undef |
CF | 2199 | heterozygote | CF-causing- Undef |
CF | 2201 | heterozygote | CF-causing- Undef |
CF | 2205 | heterozygote | CF-causing- Undef |
CF | 2218 | heterozygote | VUS4- Undef |
CF | 2219 | heterozygote | CF-causing- Undef |
CF | 2220 | heterozygote | CF-causing- Undef |
CF | 2226 | heterozygote | CF-causing- Undef |
CF | 2227 | heterozygote | CF-causing- Undef |
CF | 2231 | heterozygote | varying clinical consequence- Undef |
CF | 2235 | heterozygote | CF-causing- Undef |
CF | 2245 | heterozygote | varying clinical consequence- Undef |
CF | 2246 | heterozygote | CF-causing- Undef |
CF | 2247 | heterozygote | CF-causing- Undef |
CF | 2250 | heterozygote | CF-causing- Undef |
CF | 2253 | heterozygote | varying clinical consequence- Undef |
CF | 2257 | heterozygote | CF-causing- Undef |
CF | 2262 | heterozygote | VUS1 - Cis CF-causing - Trans |
CF | 2269 | heterozygote | CF-causing- Undef |
CF | 2274 | heterozygote | CF-causing - Trans |
CF | 2276 | heterozygote | CF-causing - Trans |
CF | 2281 | heterozygote | varying clinical consequence- Undef |
CF | 2283 | heterozygote | varying clinical consequence- Undef |
CF | 2323 | heterozygote | varying clinical consequence- Undef |
CF | 2332 | heterozygote | CF-causing- Undef |
CF | 2333 | heterozygote | CF-causing- Undef |
CF | 2339 | heterozygote | CF-causing- Undef |
CF | 2343 | heterozygote | CFTR-RD-causing - Trans |
CF | 2349 | heterozygote | CF-causing- Undef |
CF | 2350 | heterozygote | |
CF | 2361 | heterozygote | CF-causing- Undef |
CF | 2362 | heterozygote | CF-causing- Undef |
CF | 2363 | heterozygote | CF-causing- Undef |
CF | 2376 | heterozygote | CF-causing- Undef |
CF | 2380 | heterozygote | CF-causing- Undef |
CF | 2381 | heterozygote | varying clinical consequence- Undef |
CF | 2394 | heterozygote | CF-causing- Undef |
CF | 2399 | heterozygote | CF-causing- Undef |
CF | 2410 | heterozygote | CF-causing- Undef |
CF | 2429 | heterozygote | CF-causing- Undef |
CF | 2438 | heterozygote | CF-causing- Undef |
CF | 2439 | heterozygote | CF-causing- Undef |
CF | 2444 | heterozygote | CF-causing- Undef |
CF | 2452 | heterozygote | varying clinical consequence- Undef |
CF | 2458 | heterozygote | CF-causing- Undef |
CF | 2459 | heterozygote | CF-causing- Undef |
CF | 2467 | heterozygote | CF-causing- Undef |
CF | 2469 | heterozygote | CF-causing- Undef |
CF | 2472 | heterozygote | CF-causing- Undef |
CF | 2478 | heterozygote | CF-causing- Undef |
CF | 2479 | heterozygote | CF-causing- Undef |
CF | 2480 | heterozygote | CF-causing- Undef |
CF | 2482 | heterozygote | CF-causing- Undef |
CF | 2489 | heterozygote | varying clinical consequence- Undef |
CF | 2494 | heterozygote | CF-causing- Undef |
CF | 2495 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
CF | 2496 | heterozygote | varying clinical consequence- Undef |
CF | 2499 | heterozygote | CF-causing- Undef |
CF | 2510 | heterozygote | CF-causing- Undef |
CF | 2517 | heterozygote | CF-causing- Undef |
CF | 2519 | heterozygote | CF-causing- Undef |
CF | 2524 | heterozygote | VUS3 - Trans |
CF | 2534 | heterozygote | CF-causing- Undef |
CF | 2537 | heterozygote | CF-causing- Undef |
CF | 2545 | heterozygote | CF-causing- Undef |
CF | 2548 | heterozygote | CF-causing- Undef |
CF | 2550 | heterozygote | CF-causing- Undef |
CF | 2555 | heterozygote | CF-causing- Undef |
CF | 2557 | heterozygote | VUS4 - Trans VUS1 - Trans |
CF | 2558 | heterozygote | VUS4 - Trans VUS1 - Trans |
CF | 2560 | heterozygote | CF-causing- Undef |
CF | 2563 | heterozygote | CF-causing - Trans |
CF | 2568 | heterozygote | CF-causing- Undef |
CF | 2575 | heterozygote | CF-causing- Undef |
CF | 2576 | heterozygote | varying clinical consequence- Undef |
CF | 2589 | heterozygote | CF-causing- Undef |
CF | 4878 | heterozygote | varying clinical consequence- Undef |
CF | 2597 | heterozygote | varying clinical consequence- Undef CF-causing- Undef |
CF | 2598 | heterozygote | CF-causing- Undef |
CF | 4882 | heterozygote | CF-causing - Trans |
CF | 2600 | heterozygote | CF-causing- Undef |
CF | 4885 | heterozygote | CF-causing- Undef |
CF | 4892 | heterozygote | varying clinical consequence - Cis varying clinical consequence - Trans |
CF | 4893 | heterozygote | VUS3 - Trans CFTR-RD-causing- Undef VUS1- Undef |
CF | 4895 | heterozygote | varying clinical consequence- Undef |
CF | 2601 | heterozygote | CF-causing- Undef |
CF | 2602 | heterozygote | CF-causing- Undef |
CF | 4900 | heterozygote | VUS2- Undef |
CF | 4904 | heterozygote | CF-causing- Undef |
CF | 4909 | heterozygote | CF-causing - Trans |
CF | 4914 | heterozygote | VUS2 - Cis varying clinical consequence - Trans |
CF | 2604 | heterozygote | CF-causing - Trans |
CF | 4924 | heterozygote | varying clinical consequence - Trans |
CF | 2607 | heterozygote | CF-causing- Undef |
CF | 2608 | heterozygote | CF-causing- Undef |
CF | 4903 | heterozygote | VUS3 - Trans CFTR-RD-causing- Undef VUS1- Undef |
CF | 2610 | heterozygote | CF-causing- Undef |
CF | 4936 | heterozygote | CF-causing- Undef |
CF | 4938 | heterozygote | CF-causing - Trans |
CF | 4939 | heterozygote | CF-causing- Undef |
CF | 4940 | heterozygote | CF-causing- Undef |
CF | 4943 | heterozygote | CF-causing- Undef |
CF | 2616 | heterozygote | CF-causing- Undef |
CF | 4946 | heterozygote | CF-causing - Trans VUS2- Undef |
CF | 2620 | heterozygote | varying clinical consequence- Undef |
CF | 2622 | heterozygote | CF-causing- Undef |
CF | 4950 | heterozygote | CF-causing - Trans |
CF | 4952 | heterozygote | varying clinical consequence- Undef |
CF | 2624 | heterozygote | CF-causing- Undef |
CF | 2627 | heterozygote | CF-causing- Undef |
CF | 2630 | heterozygote | varying clinical consequence- Undef |
CF | 2639 | heterozygote | CF-causing- Undef |
CF | 2642 | heterozygote | CF-causing- Undef |
CF | 2644 | heterozygote | CF-causing - Trans |
CF | 2645 | heterozygote | CF-causing- Undef |
CF | 2648 | heterozygote | CF-causing- Undef |
CF | 2651 | heterozygote | CF-causing- Undef |
CF | 2654 | heterozygote | varying clinical consequence- Undef |
CF | 2655 | heterozygote | varying clinical consequence- Undef |
CF | 2656 | heterozygote | VUS2- Undef |
CF | 2658 | heterozygote | CF-causing- Undef |
CF | 2660 | heterozygote | CF-causing- Undef |
CF | 2661 | heterozygote | VUS1- Undef |
CF | 2666 | heterozygote | CF-causing- Undef |
CF | 2669 | heterozygote | CF-causing- Undef |
CF | 2673 | heterozygote | VUS3- Undef VUS3- Undef |
CF | 2678 | heterozygote | CF-causing- Undef |
CF | 5709 | heterozygote | CF-causing - Trans |
CF | 5091 | heterozygote | CF-causing - Trans |
CF | 5116 | heterozygote | varying clinical consequence- Undef |
CF | 5090 | heterozygote | CF-causing - Trans |
CF | 5898 | heterozygote | varying clinical consequence- Undef |
CF | 2679 | heterozygote | CF-causing- Undef |
CF | 2680 | heterozygote | CF-causing- Undef |
CF | 2684 | heterozygote | varying clinical consequence- Undef |
CF | 2688 | heterozygote | CF-causing - Trans |
CF | 2694 | heterozygote | CF-causing- Undef |
CF | 2701 | heterozygote | varying clinical consequence- Undef |
CF | 2712 | heterozygote | CF-causing - Trans |
CF | 2717 | heterozygote | varying clinical consequence - Trans |
CF | 2719 | heterozygote | CF-causing - Trans |
CF | 2722 | heterozygote | CF-causing - Trans |
CF | 2724 | heterozygote | varying clinical consequence- Undef |
CF | 2732 | heterozygote | varying clinical consequence- Undef |
CF | 2733 | heterozygote | varying clinical consequence - Trans |
CF | 2735 | heterozygote | CFTR-RD-causing - Trans CF-causing - Trans |
CF | 2739 | heterozygote | CF-causing - Trans |
CF | 2741 | heterozygote | CF-causing - Trans |
CF | 2744 | heterozygote | CF-causing - Trans |
CF | 2752 | heterozygote | |
CF | 2754 | heterozygote | CF-causing - Trans |
CF | 2755 | heterozygote | CF-causing - Trans |
CF | 2758 | heterozygote | CF-causing - Trans |
CF | 2761 | heterozygote | CF-causing - Trans |
CF | 2764 | heterozygote | varying clinical consequence- Undef |
CF | 2767 | heterozygote | CF-causing - Trans |
CF | 2769 | heterozygote | CF-causing - Trans |
CF | 2770 | heterozygote | CF-causing - Trans |
CF | 2772 | heterozygote | CF-causing - Trans |
CF | 2773 | heterozygote | CF-causing - Trans |
CF | 2775 | heterozygote | CF-causing- Undef |
CF | 2778 | heterozygote | CF-causing- Undef |
CF | 2779 | heterozygote | CF-causing- Undef |
CF | 2782 | heterozygote | CF-causing- Undef |
CF | 2783 | heterozygote | CF-causing - Trans |
CF | 2789 | heterozygote | CF-causing - Trans |
CF | 2795 | heterozygote | CF-causing - Trans |
CF | 2796 | heterozygote | varying clinical consequence - Trans |
CF | 2797 | heterozygote | CF-causing - Trans |
CF | 2799 | heterozygote | CF-causing- Undef |
CF | 2804 | heterozygote | CF-causing - Trans |
CF | 2807 | heterozygote | varying clinical consequence - Trans |
CF | 2809 | heterozygote | varying clinical consequence- Undef |
CF | 2812 | heterozygote | CF-causing - Trans |
CF | 2818 | heterozygote | CF-causing - Trans |
CF | 2821 | heterozygote | varying clinical consequence - Trans |
CF | 2826 | heterozygote | CF-causing - Trans |
CF | 2827 | heterozygote | varying clinical consequence - Trans |
CF | 2828 | heterozygote | CF-causing - Trans |
CF | 5014 | heterozygote | CF-causing - Trans CF-causing - Trans |
CF | 2830 | heterozygote | CF-causing - Trans |
CF | 5067 | heterozygote | varying clinical consequence - Trans VUS3- Undef |
CF | 2837 | heterozygote | varying clinical consequence - Trans |
CF | 2842 | heterozygote | varying clinical consequence - Trans |
CF | 2844 | heterozygote | CF-causing - Trans |
CF | 2848 | heterozygote | varying clinical consequence - Trans |
CF | 2850 | heterozygote | CFTR-RD-causing - Trans CF-causing - Trans |
CF | 2854 | heterozygote | CFTR-RD-causing - Trans CF-causing - Trans |
CF | 2856 | heterozygote | CF-causing- Undef |
CF | 2857 | heterozygote | CF-causing - Trans |
CF | 2859 | heterozygote | CF-causing - Trans |
CF | 2861 | heterozygote | varying clinical consequence - Trans |
CF | 2862 | heterozygote | CF-causing - Trans |
CF | 2864 | heterozygote | CF-causing - Trans |
CF | 2865 | heterozygote | CF-causing - Trans |
CF | 2870 | heterozygote | CF-causing - Trans |
CF | 2879 | heterozygote | varying clinical consequence - Trans |
CF | 2882 | heterozygote | varying clinical consequence- Undef |
CF | 2883 | heterozygote | CF-causing - Trans |
CF | 2884 | heterozygote | CF-causing - Trans |
CF | 2888 | heterozygote | CF-causing - Trans |
CF | 2889 | heterozygote | VUS1- Undef VUS4- Undef |
CF | 2891 | heterozygote | |
CF | 2893 | heterozygote | CF-causing- Undef VUS1- Undef |
CF | 2897 | heterozygote | CF-causing - Trans |
CF | 2899 | heterozygote | CF-causing - Trans |
CF | 2901 | heterozygote | CF-causing - Trans |
CF | 2903 | heterozygote | CF-causing - Trans |
CF | 2904 | heterozygote | CF-causing - Trans |
CF | 2911 | heterozygote | CF-causing - Trans |
CF | 2921 | heterozygote | CF-causing - Trans |
CF | 2932 | heterozygote | varying clinical consequence - Trans |
CF | 2937 | heterozygote | varying clinical consequence - Trans |
CF | 2938 | heterozygote | varying clinical consequence - Trans |
CF | 2939 | heterozygote | varying clinical consequence - Trans |
CF | 2942 | heterozygote | varying clinical consequence- Undef |
CF | 2950 | heterozygote | CF-causing - Trans |
CF | 2957 | heterozygote | CF-causing- Undef |
CF | 2961 | heterozygote | CF-causing - Trans |
CF | 2962 | heterozygote | varying clinical consequence - Trans |
CF | 2977 | heterozygote | CF-causing - Trans |
CF | 2983 | heterozygote | varying clinical consequence - Trans |
CF | 2996 | heterozygote | CF-causing - Trans |
CF | 2998 | heterozygote | CFTR-RD-causing - Trans CF-causing - Trans |
CF | 2999 | heterozygote | CF-causing - Trans |
CF | 3000 | heterozygote | CF-causing - Trans |
CF | 3001 | heterozygote | CF-causing - Trans |
CF | 3007 | heterozygote | CF-causing - Trans |
CF | 3008 | heterozygote | CF-causing- Undef |
CF | 3010 | heterozygote | CF-causing - Trans |
CF | 3018 | heterozygote | CF-causing - Trans |
CF | 3021 | heterozygote | varying clinical consequence - Trans |
CF | 3026 | heterozygote | VUS3 - Trans CF-causing - Trans |
CF | 3027 | heterozygote | CF-causing - Trans |
CF | 3029 | heterozygote | CF-causing - Trans |
CF | 3034 | heterozygote | varying clinical consequence - Trans |
CF | 3037 | heterozygote | CF-causing - Trans |
CF | 3045 | heterozygote | CF-causing - Trans |
CF | 3048 | heterozygote | CF-causing - Trans |
CF | 3053 | heterozygote | CF-causing - Trans |
CF | 3055 | heterozygote | CF-causing - Trans |
CF | 3056 | heterozygote | CF-causing - Trans |
CF | 3057 | heterozygote | CF-causing - Trans |
CF | 4759 | heterozygote | CF-causing - Trans |
CF | 3066 | heterozygote | CF-causing - Trans |
CF | 3070 | heterozygote | CF-causing - Trans |
CF | 3082 | heterozygote | CF-causing - Trans |
CF | 3086 | heterozygote | CF-causing- Undef |
CF | 5064 | heterozygote | CF-causing - Trans |
CF | 3092 | heterozygote | varying clinical consequence- Undef |
CF | 3101 | heterozygote | CF-causing - Trans |
CF | 3103 | heterozygote | varying clinical consequence- Undef |
CF | 3107 | heterozygote | varying clinical consequence- Undef |
CF | 3108 | heterozygote | CF-causing - Trans |
CF | 3115 | heterozygote | CF-causing - Trans |
CF | 3116 | heterozygote | CF-causing - Trans |
CF | 3119 | heterozygote | CF-causing - Trans VUS1 - Trans |
CF | 3123 | heterozygote | CF-causing - Trans |
CF | 3124 | heterozygote | CF-causing- Undef |
CF | 3127 | heterozygote | CF-causing - Trans |
CF | 3131 | heterozygote | CFTR-RD-causing- Undef CF-causing- Undef |
CF | 3132 | heterozygote | CF-causing - Trans |
CF | 3134 | heterozygote | CF-causing - Trans |
CF | 3137 | heterozygote | varying clinical consequence - Trans |
CF | 3140 | heterozygote | CF-causing - Trans VUS3- Undef |
CF | 3144 | heterozygote | CF-causing - Trans |
CF | 3145 | heterozygote | CF-causing - Trans |
CF | 3149 | heterozygote | CF-causing - Trans |
CF | 3150 | heterozygote | CF-causing - Trans |
CF | 3153 | heterozygote | CF-causing - Trans |
CF | 3164 | heterozygote | CF-causing - Trans |
CF | 3177 | heterozygote | CF-causing - Trans |
CF | 3180 | heterozygote | CF-causing - Trans |
CF | 3183 | heterozygote | CF-causing- Undef |
CF | 3185 | heterozygote | CF-causing- Undef |
CF | 3188 | heterozygote | CF-causing - Trans |
CF | 3189 | heterozygote | CF-causing - Trans |
CF | 3190 | heterozygote | CF-causing - Trans |
CF | 3192 | heterozygote | CF-causing- Undef |
CF | 3194 | heterozygote | CF-causing - Trans |
CF | 3195 | heterozygote | CF-causing- Undef |
CF | 3198 | heterozygote | CF-causing- Undef |
CF | 3199 | heterozygote | CF-causing - Trans |
CF | 3200 | heterozygote | CF-causing - Trans |
CF | 3205 | heterozygote | CF-causing- Undef VUS3- Undef |
CF | 3212 | heterozygote | VUS4- Undef |
CF | 3215 | heterozygote | CF-causing- Undef |
CF | 3216 | heterozygote | CF-causing- Undef |
CF | 3217 | heterozygote | CF-causing - Trans |
CF | 3218 | heterozygote | CF-causing- Undef |
CF | 3222 | heterozygote | CF-causing - Trans |
CF | 5066 | heterozygote | CF-causing - Trans |
CF | 3227 | heterozygote | CF-causing - Trans |
CF | 3229 | heterozygote | CF-causing- Undef |
CF | 3239 | heterozygote | varying clinical consequence - Trans |
CF | 3242 | heterozygote | CF-causing - Trans |
CF | 3243 | heterozygote | CF-causing - Trans |
CF | 3251 | heterozygote | CF-causing - Trans |
CF | 3255 | heterozygote | CF-causing - Trans |
CF | 3256 | heterozygote | CF-causing - Trans |
CF | 3260 | heterozygote | CF-causing - Trans |
CF | 3275 | heterozygote | CF-causing - Trans VUS3- Undef |
CF | 3287 | heterozygote | varying clinical consequence - Trans |
CF | 3289 | heterozygote | varying clinical consequence - Trans |
CF | 3294 | heterozygote | CF-causing - Trans |
CF | 3297 | heterozygote | CF-causing - Trans |
CF | 3298 | heterozygote | varying clinical consequence - Trans |
CF | 3302 | heterozygote | CF-causing - Trans |
CF | 4629 | heterozygote | CF-causing - Trans VUS1- Undef |
CF | 3308 | heterozygote | CF-causing - Trans |
CF | 3320 | heterozygote | CF-causing - Trans |
CF | 3328 | heterozygote | CF-causing - Trans |
CF | 3330 | heterozygote | CF-causing - Trans |
CF | 3336 | heterozygote | CF-causing - Trans |
CF | 3337 | heterozygote | CF-causing - Trans |
CF | 3347 | heterozygote | CF-causing - Trans |
CF | 4764 | heterozygote | CF-causing- Undef |
CF | 4744 | heterozygote | VUS3- Undef |
CF | 4747 | heterozygote | CF-causing- Undef |
CF | 3383 | heterozygote | CF-causing - Trans |
CF | 3384 | heterozygote | CF-causing - Trans |
CF | 5006 | heterozygote | CF-causing - Trans |
CF | 3398 | heterozygote | CF-causing- Undef |
CF | 3400 | heterozygote | CF-causing - Trans |
CF | 3407 | heterozygote | CF-causing - Trans |
CF | 3409 | heterozygote | varying clinical consequence - Trans |
CF | 3410 | heterozygote | CF-causing - Trans |
CF | 3413 | heterozygote | CF-causing - Trans |
CF | 3418 | heterozygote | CF-causing - Trans |
CF | 3419 | heterozygote | CF-causing - Trans |
CF | 5174 | heterozygote | varying clinical consequence - Trans |
CF | 5345 | heterozygote | varying clinical consequence - Trans |
CF | 5168 | heterozygote | CF-causing - Trans VUS3- Undef VUS3- Undef |
CF | 5169 | heterozygote | CF-causing - Trans |
CF | 5348 | heterozygote | CF-causing - Trans |
CF | 5337 | heterozygote | CF-causing - Trans |
CF | 5622 | heterozygote | varying clinical consequence - Trans |
CF | 5767 | heterozygote | CF-causing- Undef |
CF | 5963 | heterozygote | CF-causing - Trans |
CF | 5965 | heterozygote | varying clinical consequence- Undef |
CF | 5574 | heterozygote | VUS3 - Trans VUS3 - Trans |
CF | 5335 | heterozygote | CF-causing - Trans |
CF | 3426 | heterozygote | varying clinical consequence- Undef |
CF | 3431 | heterozygote | CF-causing- Undef |
CF | 3435 | heterozygote | CF-causing- Undef |
CF | 3436 | heterozygote | CF-causing- Undef |
CF | 3439 | heterozygote | CF-causing- Undef |
CF | 3445 | heterozygote | CF-causing- Undef |
CF | 3448 | heterozygote | CF-causing- Undef |
CF | 3450 | heterozygote | CF-causing - Trans |
CF | 3456 | heterozygote | CF-causing- Undef |
CF | 3457 | heterozygote | CF-causing- Undef |
CF | 3459 | heterozygote | CF-causing- Undef |
CF | 3460 | heterozygote | CF-causing- Undef |
CF | 3466 | heterozygote | varying clinical consequence- Undef |
CF | 3467 | heterozygote | varying clinical consequence- Undef |
CF | 3469 | heterozygote | CF-causing- Undef |
CF | 3470 | heterozygote | CF-causing- Undef |
CF | 3476 | heterozygote | CF-causing - Trans |
CF | 3479 | heterozygote | VUS4 - Trans |
CF | 3481 | heterozygote | CF-causing- Undef |
CF | 3485 | heterozygote | CF-causing- Undef |
CF | 3486 | heterozygote | CF-causing- Undef |
CF | 3487 | heterozygote | CF-causing- Undef |
CF | 3488 | heterozygote | CF-causing- Undef |
CF | 3489 | heterozygote | CF-causing- Undef |
CF | 3490 | heterozygote | CF-causing- Undef |
CF | 3491 | heterozygote | CF-causing- Undef |
CF | 3493 | heterozygote | CF-causing- Undef |
CF | 3495 | heterozygote | CF-causing - Trans |
CF | 3498 | heterozygote | CF-causing - Trans |
CF | 3501 | heterozygote | CF-causing- Undef |
CF | 3502 | heterozygote | CF-causing- Undef |
CF | 3503 | heterozygote | CF-causing- Undef |
CF | 3506 | heterozygote | CF-causing- Undef |
CF | 3507 | heterozygote | CF-causing- Undef |
CF | 3509 | heterozygote | CF-causing - Trans |
CF | 3513 | heterozygote | CF-causing- Undef |
CF | 3518 | heterozygote | CF-causing - Trans |
CF | 3523 | heterozygote | CF-causing- Undef |
CF | 3524 | heterozygote | CF-causing- Undef |
CF | 3525 | heterozygote | CF-causing - Trans |
CF | 3526 | heterozygote | CF-causing- Undef |
CF | 3532 | heterozygote | CF-causing - Trans |
CF | 3544 | heterozygote | CF-causing- Undef |
CF | 3545 | heterozygote | CF-causing - Trans |
CF | 3546 | heterozygote | CF-causing - Trans |
CF | 3547 | heterozygote | CF-causing - Trans |
CF | 3549 | heterozygote | CF-causing- Undef |
CF | 3556 | heterozygote | varying clinical consequence- Undef |
CF | 3564 | heterozygote | CF-causing- Undef |
CF | 3565 | heterozygote | CF-causing- Undef |
CF | 3566 | heterozygote | CF-causing - Trans |
CF | 3568 | heterozygote | CF-causing - Trans |
CF | 3576 | heterozygote | CF-causing- Undef |
CF | 3583 | heterozygote | CF-causing- Undef |
CF | 3584 | heterozygote | CF-causing - Trans |
CF | 3585 | heterozygote | CF-causing - Trans |
CF | 3586 | heterozygote | CF-causing - Trans |
CF | 3595 | heterozygote | CF-causing- Undef |
CF | 3599 | heterozygote | CF-causing- Undef |
CF | 3600 | heterozygote | CF-causing - Trans |
CF | 3603 | heterozygote | CF-causing- Undef |
CF | 3604 | heterozygote | CF-causing- Undef |
CF | 3609 | heterozygote | CF-causing- Undef |
CF | 3610 | heterozygote | CF-causing- Undef |
CF | 3615 | heterozygote | CF-causing- Undef |
CF | 3617 | heterozygote | CF-causing - Trans |
CF | 3618 | heterozygote | CF-causing- Undef |
CF | 3620 | heterozygote | CF-causing- Undef |
CF | 3625 | heterozygote | varying clinical consequence- Undef |
CF | 3626 | heterozygote | CF-causing- Undef |
CF | 3629 | heterozygote | CF-causing - Trans |
CF | 3630 | heterozygote | CF-causing - Trans |
CF | 3635 | heterozygote | CF-causing - Trans |
CF | 3639 | heterozygote | CF-causing - Trans |
CF | 3641 | heterozygote | CF-causing- Undef |
CF | 3646 | heterozygote | CF-causing - Trans |
CF | 3647 | heterozygote | CF-causing - Trans |
CF | 3649 | heterozygote | CF-causing- Undef |
CF | 3653 | heterozygote | CF-causing- Undef |
CF | 3654 | heterozygote | CF-causing - Trans |
CF | 3656 | heterozygote | CF-causing- Undef |
CF | 3661 | heterozygote | CF-causing- Undef |
CF | 3664 | heterozygote | CF-causing- Undef |
CF | 3666 | heterozygote | CF-causing- Undef |
CF | 3678 | heterozygote | CF-causing - Trans |
CF | 3679 | heterozygote | CF-causing - Trans |
CF | 3680 | heterozygote | CF-causing- Undef |
CF | 3684 | heterozygote | CF-causing- Undef |
CF | 3685 | heterozygote | CF-causing - Trans |
CF | 3688 | heterozygote | CF-causing- Undef |
CF | 4965 | heterozygote | varying clinical consequence- Undef VUS3- Undef |
CF | 3693 | heterozygote | CF-causing - Trans |
CF | 3695 | heterozygote | CF-causing- Undef |
CF | 3696 | heterozygote | CF-causing- Undef |
CF | 3697 | heterozygote | CF-causing- Undef |
CF | 3699 | heterozygote | |
CF | 3703 | heterozygote | CF-causing- Undef |
CF | 3710 | heterozygote | CF-causing - Trans |
CF | 3714 | heterozygote | CF-causing- Undef |
CF | 3717 | heterozygote | CF-causing- Undef |
CF | 3720 | heterozygote | CF-causing - Trans |
CF | 3723 | heterozygote | CF-causing- Undef |
CF | 3725 | heterozygote | CF-causing - Trans |
CF | 3732 | heterozygote | CF-causing- Undef |
CF | 3736 | heterozygote | CF-causing- Undef |
CF | 3739 | heterozygote | CF-causing - Trans |
CF | 3740 | heterozygote | CF-causing - Trans VUS4 - Trans |
CF | 3741 | heterozygote | CF-causing - Trans |
CF | 3743 | heterozygote | CF-causing - Trans |
CF | 3745 | heterozygote | varying clinical consequence - Trans |
CF | 3746 | heterozygote | CF-causing- Undef |
CF | 3749 | heterozygote | CF-causing- Undef |
CF | 3751 | heterozygote | CF-causing- Undef |
CF | 3754 | heterozygote | CF-causing- Undef |
CF | 3762 | heterozygote | CF-causing- Undef |
CF | 3764 | heterozygote | CF-causing- Undef |
CF | 3765 | heterozygote | CF-causing - Trans |
CF | 3772 | heterozygote | CF-causing- Undef |
CF | 3778 | heterozygote | CF-causing - Trans |
CF | 3788 | heterozygote | varying clinical consequence- Undef |
CF | 3792 | heterozygote | CF-causing - Trans |
CF | 3795 | heterozygote | CF-causing- Undef |
CF | 3797 | heterozygote | CF-causing- Undef |
CF | 3801 | heterozygote | CF-causing- Undef |
CF | 3808 | heterozygote | CF-causing - Trans |
CF | 3820 | heterozygote | CF-causing- Undef |
CF | 3822 | heterozygote | varying clinical consequence- Undef |
CF | 3824 | heterozygote | CF-causing - Trans |
CF | 3825 | heterozygote | CF-causing- Undef |
CF | 3826 | heterozygote | CF-causing- Undef |
CF | 3828 | heterozygote | CF-causing- Undef |
CF | 3830 | heterozygote | CF-causing- Undef |
CF | 3832 | heterozygote | CF-causing - Trans |
CF | 3834 | heterozygote | CF-causing- Undef |
CF | 3835 | heterozygote | CF-causing- Undef |
CF | 3839 | heterozygote | CF-causing- Undef |
CF | 3847 | heterozygote | VUS4- Undef |
CF | 3848 | heterozygote | CF-causing- Undef |
CF | 3850 | heterozygote | varying clinical consequence- Undef |
CF | 3851 | heterozygote | CF-causing- Undef |
CF | 3853 | heterozygote | CF-causing - Trans |
CF | 3854 | heterozygote | CF-causing - Trans |
CF | 3858 | heterozygote | CF-causing- Undef |
CF | 3859 | heterozygote | CF-causing- Undef |
CF | 3864 | heterozygote | CF-causing - Trans |
CF | 3867 | heterozygote | CF-causing- Undef |
CF | 3869 | heterozygote | CF-causing - Trans |
CF | 3871 | heterozygote | CF-causing- Undef |
CF | 3873 | heterozygote | CF-causing - Trans |
CF | 3886 | heterozygote | CF-causing- Undef |
CF | 3887 | heterozygote | CF-causing- Undef |
CF | 3892 | heterozygote | CF-causing- Undef |
CF | 3904 | heterozygote | CF-causing- Undef |
CF | 3912 | heterozygote | CF-causing - Trans |
CF | 3915 | heterozygote | CF-causing- Undef |
CF | 3916 | heterozygote | CF-causing- Undef |
CF | 3917 | heterozygote | varying clinical consequence - Trans |
CF | 3921 | heterozygote | CF-causing- Undef |
CF | 3934 | heterozygote | CF-causing - Trans |
CF | 3936 | heterozygote | CF-causing- Undef |
CF | 3937 | heterozygote | CF-causing- Undef |
CF | 3940 | heterozygote | CF-causing - Trans |
CF | 3944 | heterozygote | CF-causing- Undef |
CF | 3952 | heterozygote | CF-causing- Undef |
CF | 3953 | heterozygote | CF-causing- Undef |
CF | 3956 | heterozygote | CF-causing- Undef |
CF | 3960 | heterozygote | CF-causing- Undef |
CF | 3965 | heterozygote | CF-causing- Undef |
CF | 3966 | heterozygote | CF-causing- Undef |
CF | 3969 | heterozygote | CF-causing - Trans |
CF | 3973 | heterozygote | CF-causing- Undef |
CF | 3985 | heterozygote | CF-causing- Undef |
CF | 3988 | heterozygote | CF-causing - Trans |
CF | 3990 | heterozygote | CF-causing - Trans |
CF | 3994 | heterozygote | varying clinical consequence- Undef |
CF | 3995 | heterozygote | CF-causing - Trans |
CF | 4003 | heterozygote | CF-causing - Trans |
CF | 4004 | heterozygote | CF-causing- Undef |
CF | 4005 | heterozygote | CF-causing- Undef |
CF | 4006 | heterozygote | CF-causing- Undef |
CF | 4012 | heterozygote | CF-causing- Undef |
CF | 4013 | heterozygote | CF-causing - Trans |
CF | 4022 | heterozygote | CF-causing- Undef |
CF | 4026 | heterozygote | CF-causing - Trans |
CF | 5790 | heterozygote | VUS3- Undef |
CF | 4028 | heterozygote | CF-causing - Trans |
CF | 4038 | heterozygote | CF-causing- Undef |
CF | 4040 | heterozygote | CF-causing- Undef |
CF | 4044 | heterozygote | varying clinical consequence - Trans |
CF | 4045 | heterozygote | CF-causing- Undef |
CF | 4046 | heterozygote | CF-causing- Undef |
CF | 4048 | heterozygote | CF-causing- Undef |
CF | 4050 | heterozygote | CF-causing- Undef |
CF | 4051 | heterozygote | CF-causing - Trans |
CF | 4053 | heterozygote | CF-causing - Trans |
CF | 4055 | heterozygote | CF-causing- Undef |
CF | 4056 | heterozygote | CF-causing- Undef |
CF | 4060 | heterozygote | CF-causing - Trans |
CF | 4061 | heterozygote | CF-causing- Undef |
CF | 4066 | heterozygote | CF-causing- Undef |
CF | 4069 | heterozygote | CF-causing - Trans |
CF | 4072 | heterozygote | VUS2- Undef |
CF | 4074 | heterozygote | CF-causing- Undef |
CF | 4076 | heterozygote | CF-causing- Undef |
CF | 4079 | heterozygote | CF-causing- Undef |
CF | 4080 | heterozygote | CF-causing- Undef |
CF | 4083 | heterozygote | CF-causing- Undef |
CF | 4087 | heterozygote | varying clinical consequence- Undef |
CF | 4090 | heterozygote | CF-causing- Undef |
CF | 4096 | heterozygote | CF-causing - Trans |
CF | 4101 | heterozygote | CF-causing- Undef |
CF | 4103 | heterozygote | CF-causing- Undef |
CF | 4104 | heterozygote | CF-causing- Undef |
CF | 4106 | heterozygote | CF-causing- Undef |
CF | 4107 | heterozygote | CF-causing- Undef |
CF | 4108 | heterozygote | CF-causing- Undef |
CF | 4112 | heterozygote | CF-causing - Trans |
CF | 4114 | heterozygote | CF-causing - Trans |
CF | 4117 | heterozygote | CF-causing - Trans |
CF | 4126 | heterozygote | CF-causing - Trans |
CF | 4128 | heterozygote | varying clinical consequence - Trans |
CF | 4129 | heterozygote | CF-causing- Undef |
CF | 4133 | heterozygote | varying clinical consequence - Trans |
CF | 4136 | heterozygote | CF-causing- Undef |
CF | 4142 | heterozygote | varying clinical consequence - Trans |
CF | 4143 | heterozygote | CF-causing - Trans |
CF | 4144 | heterozygote | CF-causing - Trans |
CF | 4150 | heterozygote | CF-causing- Undef |
CF | 4157 | heterozygote | CF-causing- Undef |
CF | 4160 | heterozygote | CF-causing - Trans |
CF | 4167 | heterozygote | CF-causing- Undef |
CF | 4171 | heterozygote | varying clinical consequence - Trans |
CF | 4172 | heterozygote | CF-causing- Undef |
CF | 4181 | heterozygote | CF-causing - Trans |
CF | 4186 | heterozygote | CF-causing- Undef |
CF | 4189 | heterozygote | CF-causing- Undef |
CF | 4194 | heterozygote | CF-causing- Undef |
CF | 4196 | heterozygote | CF-causing- Undef |
CF | 5759 | heterozygote | CF-causing - Trans VUS3 - Trans |
CF | 4206 | heterozygote | CF-causing- Undef |
CF | 4222 | heterozygote | CF-causing - Trans |
CF | 4227 | heterozygote | CF-causing - Trans |
CF | 4230 | heterozygote | VUS2 - Cis CF-causing - Trans |
CF | 4236 | heterozygote | CFTR-RD-causing - Trans CF-causing - Trans |
CF | 4251 | heterozygote | CF-causing - Trans |
CF | 4254 | heterozygote | CF-causing- Undef |
CF | 4267 | heterozygote | CF-causing - Trans VUS1 - Trans |
CF | 4268 | heterozygote | varying clinical consequence- Undef |
CF | 4274 | heterozygote | CF-causing - Trans |
CF | 4277 | heterozygote | CF-causing- Undef |
CF | 4283 | heterozygote | CF-causing - Trans |
CF | 4284 | heterozygote | CF-causing - Trans |
CF | 4290 | heterozygote | CF-causing - Trans |
CF | 4297 | heterozygote | CF-causing - Trans |
CF | 4306 | heterozygote | CF-causing - Trans |
CF | 4307 | heterozygote | CF-causing - Trans |
CF | 4323 | heterozygote | CF-causing - Trans |
CF | 4325 | heterozygote | varying clinical consequence - Trans |
CF | 4804 | heterozygote | CF-causing- Undef |
CF | 4807 | heterozygote | CF-causing- Undef |
CF | 4326 | heterozygote | CF-causing - Trans |
CF | 4329 | heterozygote | CF-causing - Trans |
CF | 4335 | heterozygote | VUS4- Undef |
CF | 4341 | heterozygote | VUS1 - Cis CF-causing - Trans |
CF | 4344 | heterozygote | CF-causing- Undef |
CF | 4347 | heterozygote | CF-causing - Trans |
CF | 4348 | heterozygote | CF-causing- Undef |
CF | 4349 | heterozygote | varying clinical consequence - Trans |
CF | 4351 | heterozygote | varying clinical consequence- Undef |
CF | 4357 | heterozygote | CF-causing- Undef |
CF | 4360 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CF-causing- Undef |
CF | 4361 | heterozygote | |
CF | 4363 | heterozygote | |
CF | 4364 | heterozygote | CF-causing - Trans |
CF | 4365 | heterozygote | CF-causing - Trans |
CF | 4368 | heterozygote | CF-causing - Trans |
CF | 4376 | heterozygote | varying clinical consequence- Undef |
CF | 4380 | heterozygote | CF-causing- Undef |
CF | 4381 | heterozygote | CF-causing- Undef |
CF | 4383 | heterozygote | CF-causing - Trans |
CF | 4387 | heterozygote | CF-causing- Undef |
CF | 4391 | heterozygote | CF-causing - Trans |
CF | 4394 | heterozygote | CF-causing- Undef |
CF | 4395 | heterozygote | CF-causing - Trans |
CF | 4396 | heterozygote | CF-causing- Undef |
CF | 4397 | heterozygote | CF-causing - Trans |
CF | 4398 | heterozygote | CF-causing - Trans |
CF | 4400 | heterozygote | CF-causing- Undef |
CF | 4401 | heterozygote | varying clinical consequence - Trans |
CF | 4406 | heterozygote | VUS2- Undef CF-causing- Undef |
CF | 4413 | heterozygote | CF-causing - Trans |
CF | 4417 | heterozygote | CF-causing - Trans |
CF | 4427 | heterozygote | CF-causing - Trans |
CF | 4432 | heterozygote | CF-causing - Trans |
CF | 4435 | heterozygote | varying clinical consequence - Trans |
CF | 4437 | heterozygote | CF-causing - Trans |
CF | 4439 | heterozygote | VUS5 - Trans |
CF | 4440 | heterozygote | CF-causing - Trans |
CF | 4441 | heterozygote | CF-causing - Trans |
CF | 4442 | heterozygote | CF-causing - Trans |
CF | 4452 | heterozygote | CF-causing- Undef |
CF | 4460 | heterozygote | CF-causing - Trans |
CF | 4461 | heterozygote | CF-causing- Undef |
CF | 4462 | heterozygote | VUS4 - Trans |
CF | 4463 | heterozygote | varying clinical consequence - Trans |
CF | 4464 | heterozygote | varying clinical consequence - Trans |
CF | 4465 | heterozygote | CF-causing - Trans |
CF | 4466 | heterozygote | CF-causing - Trans |
CF | 4470 | heterozygote | CF-causing - Trans |
CF | 4471 | heterozygote | CF-causing - Trans |
CF | 4473 | heterozygote | CF-causing - Trans |
CF | 4477 | heterozygote | CF-causing - Trans |
CF | 4479 | heterozygote | varying clinical consequence - Trans |
CF | 4481 | heterozygote | CF-causing- Undef |
CF | 4482 | heterozygote | CF-causing - Trans VUS1- Undef |
CF | 4483 | heterozygote | varying clinical consequence- Undef |
CF | 4493 | heterozygote | CF-causing - Trans |
CF | 4494 | heterozygote | CF-causing - Trans |
CF | 4496 | heterozygote | CF-causing - Trans |
CF | 4499 | heterozygote | varying clinical consequence - Trans |
CF | 4502 | heterozygote | varying clinical consequence - Trans |
CF | 4507 | heterozygote | CF-causing- Undef |
CF | 4510 | heterozygote | CF-causing - Trans |
CF | 4514 | heterozygote | CF-causing - Trans |
CF | 4519 | heterozygote | CF-causing- Undef |
CF | 4521 | heterozygote | CF-causing - Trans |
CF | 4525 | heterozygote | CF-causing- Undef |
CF | 4535 | heterozygote | CF-causing - Trans |
CF | 4560 | heterozygote | VUS4- Undef |
CF | 4580 | heterozygote | CF-causing - Trans |
CF | 4585 | heterozygote | CF-causing - Trans |
CF | 4591 | heterozygote | VUS2 - Trans |
CF | 4594 | heterozygote | CF-causing - Trans VUS1- Undef |
CF | 4596 | heterozygote | CF-causing - Trans |
CF | 4605 | heterozygote | varying clinical consequence - Trans |
CF | 4610 | heterozygote | CF-causing - Trans |
CF | 6040 | heterozygote | CF-causing- Undef |
CF | 6171 | heterozygote | CF-causing- Undef |
CF | 6082 | heterozygote | varying clinical consequence- Undef |
CF | 6102 | heterozygote | CF-causing - Trans |
CF | 6085 | heterozygote | CF-causing- Undef |
CF | 6086 | heterozygote | CF-causing - Trans |
CF | 6165 | heterozygote | VUS5- Undef |
CF | 6088 | heterozygote | CF-causing - Trans |
CF | 6091 | heterozygote | CF-causing - Trans |
CF | 6094 | heterozygote | CF-causing- Undef |
CF | 6096 | heterozygote | varying clinical consequence- Undef |
CF | 6203 | heterozygote | varying clinical consequence- Undef |
CF | 6177 | heterozygote | CF-causing- Undef |
CF | 6168 | heterozygote | CF-causing - Trans |
CF | 6202 | heterozygote | varying clinical consequence - Trans |
CF | 6170 | heterozygote | CF-causing- Undef |
CF | 6197 | heterozygote | varying clinical consequence- Undef |
CF | 6162 | heterozygote | CF-causing - Trans |
CF | 6106 | heterozygote | VUS3 - Trans |
CF | 6159 | heterozygote | CF-causing - Trans |
CF | 6181 | heterozygote | CF-causing - Trans |
CF | 5993 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
CF | 6166 | heterozygote | CF-causing- Undef |
CF | 6002 | heterozygote | VUS3 - Trans |
CF | 6006 | heterozygote | varying clinical consequence- Undef |
CF | 6005 | heterozygote | varying clinical consequence - Trans |
CF | 6007 | heterozygote | CF-causing - Trans |
CF | 6009 | heterozygote | varying clinical consequence- Undef |
CF | 6013 | heterozygote | varying clinical consequence - Trans |
CF | 6160 | heterozygote | CFTR-RD-causing - Trans varying clinical consequence - Trans |
CF | 6016 | heterozygote | CF-causing- Undef |
CF | 6018 | heterozygote | CF-causing - Trans |
CF | 6164 | heterozygote | VUS3 - Trans |
CF | 6021 | heterozygote | VUS4 - Trans |
CF | 6022 | heterozygote | VUS3 - Trans |
CF | 6026 | heterozygote | CF-causing - Trans |
CF | 6029 | heterozygote | CF-causing - Trans |
CF | 6104 | heterozygote | VUS3- Undef |
CF | 6107 | heterozygote | CF-causing - Trans |
CF | 6184 | heterozygote | varying clinical consequence - Trans |
CF | 6110 | heterozygote | VUS3 - Trans |
CF | 5282 | heterozygote | varying clinical consequence - Trans |
CF | 6176 | heterozygote | CF-causing - Trans |
CF | 6034 | heterozygote | varying clinical consequence - Trans |
CF | 6036 | heterozygote | CF-causing- Undef |
CF | 6109 | heterozygote | CF-causing - Trans |
CF | 6163 | heterozygote | CF-causing- Undef |
CF | 6023 | heterozygote | CF-causing- Undef |
CF | 6108 | heterozygote | VUS3 - Trans |
CF | 3252 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3254 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3258 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3263 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3278 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3283 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3285 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3296 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3299 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3304 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3319 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3340 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3342 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3345 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3348 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3350 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3356 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3358 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3359 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3379 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3380 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3386 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3389 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3393 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3406 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3412 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3417 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3420 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2766 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3421 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3422 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3423 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3424 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3425 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3427 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3428 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3429 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3430 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3432 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3434 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3440 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3443 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3444 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3446 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3447 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3449 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3451 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3452 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3454 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3455 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3462 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3463 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3464 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3468 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3471 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3473 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3474 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3475 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3480 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3482 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3483 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3484 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3494 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3496 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3497 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3499 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3500 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3508 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3510 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3511 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3514 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3515 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3516 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3517 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3519 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3520 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3521 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3522 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3527 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3528 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3529 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3530 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3531 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3533 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3534 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3535 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3537 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3538 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3541 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3542 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3543 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3550 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3551 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3552 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3553 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3554 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3557 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3558 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3559 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3560 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3561 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3562 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3563 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3567 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3569 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3572 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3573 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3577 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3580 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3581 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3582 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3588 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3592 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3593 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3594 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3596 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3597 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3601 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3602 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3605 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3606 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3607 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3611 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3612 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3613 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3614 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3616 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3619 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3622 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3623 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3624 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3627 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3631 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3632 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3633 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3634 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3636 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3637 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3638 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3640 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3642 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3643 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3644 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3645 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3650 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3651 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3652 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3657 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3659 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3662 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3665 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3669 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3670 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3671 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3673 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3675 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3681 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3683 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3686 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3687 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3689 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3690 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3691 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3694 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3700 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3701 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3702 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3704 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3705 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3706 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3708 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3709 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3711 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3712 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3715 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3716 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3718 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3719 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3721 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3722 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3726 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3727 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3729 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3730 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3731 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3733 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3735 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3738 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3742 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3744 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3748 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3750 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3752 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3753 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3756 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3758 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3761 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3767 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3768 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3769 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3774 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3779 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3780 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3781 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3782 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3783 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3785 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3786 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3789 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3790 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3791 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3793 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3796 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3799 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3800 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3802 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3804 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3805 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3806 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3807 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3811 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3812 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3813 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3814 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3815 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3818 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3819 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3821 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3827 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3829 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3831 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3833 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3836 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3837 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3838 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3840 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3841 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3843 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3844 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3845 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3846 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3849 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3852 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3855 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3856 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3857 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3860 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3863 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3866 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3868 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3870 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3874 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3878 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3879 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3880 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3882 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3883 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3885 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3888 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3889 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3890 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3891 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3893 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3894 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3895 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3896 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3897 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3898 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3899 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3900 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3902 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3903 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3906 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3907 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3910 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3911 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3913 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3914 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3918 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3920 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3922 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3923 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3924 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3927 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3928 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3929 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3931 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3932 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3933 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3935 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3938 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3939 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3941 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3942 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3943 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3945 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3946 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3947 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3948 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3949 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3950 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3954 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3955 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3957 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3961 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3962 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3963 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3964 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3967 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3968 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3970 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3971 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3972 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3974 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3975 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3976 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3977 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3979 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3981 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3983 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3984 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3986 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3987 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3991 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3992 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3993 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3996 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3997 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3998 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3999 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4000 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4001 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4002 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4007 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4008 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4009 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4011 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4015 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4016 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4017 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4021 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4023 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4025 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4027 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4029 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4031 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4032 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4033 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4034 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4036 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4037 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4039 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4041 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4049 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4057 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4059 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4065 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4067 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4068 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4070 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4071 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4073 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4077 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4081 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4082 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4084 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4085 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4088 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4089 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4092 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4093 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4094 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4095 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4097 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4100 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4102 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4110 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4111 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4116 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4118 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4120 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4121 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4124 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4125 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4127 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4131 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4132 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4134 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4135 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4138 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4139 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4140 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4141 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4147 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4148 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4149 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4151 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4152 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4153 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4154 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4155 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4156 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4158 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4161 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4162 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4163 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4168 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4170 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4175 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4176 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4177 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4178 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4179 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4183 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4184 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4187 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4188 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4190 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4191 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4192 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4195 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4197 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4198 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4199 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4200 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4201 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4203 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4204 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4205 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4208 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4209 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4210 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4211 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4212 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4213 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4214 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4216 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4217 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4219 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4220 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4221 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4245 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4272 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4281 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4282 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4294 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4302 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4328 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4330 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4334 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4342 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4346 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4350 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4352 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4353 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4355 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4356 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4362 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4366 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4367 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4369 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4370 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4371 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4372 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4373 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4374 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4377 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4378 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4382 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4385 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4388 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4389 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4392 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4393 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4402 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4403 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4404 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4405 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4412 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4423 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4424 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4425 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4426 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4428 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4429 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4430 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4433 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4436 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4438 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4444 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4445 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4446 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4447 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4448 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4449 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4450 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4451 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4454 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4455 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4456 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4457 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4459 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4467 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4468 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4469 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4475 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4478 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4490 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4491 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4492 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4495 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4497 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4498 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4500 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4501 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4504 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4506 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4509 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4511 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4527 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4603 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 5 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 9 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 10 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 13 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 15 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 18 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 20 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 21 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 24 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 29 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 30 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 31 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 34 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 35 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 40 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 42 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 44 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 48 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 49 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 50 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 54 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 55 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 56 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 58 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 60 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 66 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 67 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 71 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 72 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 74 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 75 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 77 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 78 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 84 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 85 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 93 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 104 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 106 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 108 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 115 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 116 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 118 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 125 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 134 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 135 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 142 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 144 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 150 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 155 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 189 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 191 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 192 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 226 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 235 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 241 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 250 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 256 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 260 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 268 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 273 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 278 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 279 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 296 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 300 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 301 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 302 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 311 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 325 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 329 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 337 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 339 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 342 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 345 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 364 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 376 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 378 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 388 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 415 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 442 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 457 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 487 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 554 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 563 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 568 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.2770G>A - p.(Asp924Asn) - Trans |
CF | 569 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 573 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 581 | homozygote | c.1399C>T - p.(Leu467Phe) - Trans c.1521_1523del - p.(Phe508del) - Trans |
CF | 585 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 587 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 592 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 593 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 595 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 603 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 606 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 608 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 610 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 618 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 624 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 628 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 629 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 630 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 634 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 635 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 638 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 667 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 670 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 673 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 685 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 694 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 699 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 700 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 708 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 709 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 713 | homozygote | c.1399C>T - p.(Leu467Phe) - Trans c.1521_1523del - p.(Phe508del) - Trans |
CF | 719 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 727 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 741 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 749 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 750 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 754 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 759 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 764 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 797 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 807 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 809 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 811 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 827 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 830 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 831 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 833 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 839 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 847 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 854 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 855 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 862 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 865 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 866 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 870 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 898 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 902 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 903 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 905 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 915 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 933 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 939 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 942 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 946 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 974 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 979 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 982 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 995 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3080T>C - p.(Ile1027Thr) - Trans |
CF | 996 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1001 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1003 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1009 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 5355 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.53+4A>T - p.(=) - Trans |
CF | 1015 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1020 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1023 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4771 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4772 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1028 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1029 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 4779 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1032 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1033 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1034 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1035 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1037 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1038 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1039 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1043 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1046 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1049 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1051 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1053 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1054 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1058 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1060 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1079 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1080 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1084 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1102 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1104 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1105 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1106 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1108 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1111 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1112 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1115 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1122 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1127 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1129 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1135 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1143 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1144 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1145 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1147 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1149 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1154 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1156 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1162 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1167 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1175 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1176 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1179 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1182 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1183 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1188 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1194 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1195 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1198 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1200 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1202 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1204 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1207 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1208 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1209 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1210 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1213 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1214 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1215 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1216 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1218 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1219 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1221 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1229 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1249 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1275 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1282 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1523 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1548 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1552 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1582 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1587 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1588 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1591 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1592 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1594 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1595 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1599 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1601 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1602 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1603 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1607 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1609 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1611 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1613 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1615 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1617 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1619 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1621 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1624 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1625 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1626 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1633 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1636 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1637 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1641 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1643 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1645 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1646 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1647 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1648 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1649 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1651 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1661 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1670 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1671 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1675 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1681 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1687 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1688 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1694 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1695 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1708 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1709 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1711 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1715 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1719 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1721 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1723 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1726 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1727 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1730 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1731 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1732 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1733 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1734 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1739 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3080T>C - p.(Ile1027Thr) - Trans |
CF | 1742 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1750 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1751 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1754 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1755 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1765 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1766 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1767 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1769 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1773 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1777 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1781 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1784 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1785 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1791 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1793 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1797 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1799 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1802 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1803 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1804 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1806 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1808 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1811 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1813 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1823 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1827 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1828 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1830 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1831 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1835 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1843 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1845 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1847 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1848 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1850 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1853 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1858 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1865 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1869 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1870 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1872 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1874 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1876 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1880 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1882 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1892 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1895 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1899 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1900 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1901 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1906 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1907 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1910 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1911 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1912 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1914 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1917 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1922 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1923 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1924 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1938 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1941 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1942 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1946 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1951 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1952 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1953 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1954 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1971 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1977 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1983 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1984 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1988 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1989 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1992 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1993 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 1996 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2002 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2003 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2010 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2012 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2018 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2019 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2020 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2024 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2027 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2028 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2030 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2031 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2034 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2041 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2043 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2047 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2049 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2054 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2057 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2058 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2063 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2064 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2068 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2069 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2070 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2074 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2079 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2085 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2087 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2092 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2093 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2102 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2103 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2104 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2106 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2107 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2113 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2115 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2116 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2117 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2123 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2130 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2133 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2135 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2136 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2143 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2144 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2145 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2149 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2151 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2152 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2157 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2160 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2161 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2163 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2164 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2166 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2167 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2169 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2171 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2173 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2180 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2184 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2186 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2187 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2190 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2194 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2196 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2200 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2206 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2207 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2209 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2213 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2215 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2223 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2224 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2230 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2233 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2236 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2237 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2239 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2240 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2251 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2256 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2259 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2267 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2268 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2270 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2271 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2272 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2278 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2282 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2284 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2288 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2290 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2293 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2294 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2295 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2296 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2309 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2310 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2316 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2317 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2320 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2328 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2331 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2335 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2341 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2345 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2352 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2359 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2366 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2371 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2378 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2382 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2386 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2387 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2391 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2392 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2393 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2401 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2402 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2405 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2407 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2416 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2423 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2430 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2436 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2443 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2445 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2450 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2457 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2461 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2463 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2464 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2465 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2466 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2470 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2477 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2484 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2493 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2500 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2505 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2513 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2523 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2532 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2541 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2542 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2543 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2547 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2559 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2566 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2571 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2573 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2577 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2578 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2579 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2583 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2585 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2593 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2603 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2605 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2612 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2613 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2614 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2615 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2625 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2626 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2628 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2629 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2632 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2633 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2636 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2637 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2640 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2643 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2646 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2647 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2650 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2659 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2662 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2665 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2667 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2668 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2671 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2674 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2676 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2682 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2685 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2686 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2697 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2698 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2699 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2705 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2706 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2707 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2708 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2710 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2711 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2715 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2721 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2723 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2725 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2731 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2736 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2737 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2738 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2740 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2745 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2746 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2750 | homozygote | c.1521_1523del - p.(Phe508del) - Trans c.3080T>C - p.(Ile1027Thr) - Trans |
CF | 2753 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2762 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2765 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2768 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2781 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2787 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2788 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2791 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2792 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2793 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2813 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2814 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2815 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2823 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2825 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2831 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2832 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2835 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2839 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2840 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2841 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2845 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2846 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2847 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2849 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2851 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2852 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2855 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2858 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2866 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2867 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2868 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2872 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2873 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2876 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2878 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2881 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2887 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2890 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2892 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2894 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2900 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2902 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2908 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2909 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2910 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2912 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2914 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2915 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2916 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2920 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2922 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2923 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2924 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2925 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2926 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2927 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2930 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2931 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2933 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2935 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2936 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2941 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2943 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2945 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2946 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2951 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2953 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2954 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2958 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2959 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2963 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2965 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2967 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2969 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2972 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2979 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2981 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2982 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2987 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2992 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2993 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 2997 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3006 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3015 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3017 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3025 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3028 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3030 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3033 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3036 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3039 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3040 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3041 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3050 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3052 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3059 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3065 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3067 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3068 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3069 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3074 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3075 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3080 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3081 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3087 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3090 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3091 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3093 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3095 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3096 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3102 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3105 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3106 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3110 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3111 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3112 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3114 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3117 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3121 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3128 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3129 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3130 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3133 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3136 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3139 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3146 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3147 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3151 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3155 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3157 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3158 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3159 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3162 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3166 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3170 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3172 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3173 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3174 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3175 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3176 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3178 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3181 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3184 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3187 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3196 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3197 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3202 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3203 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3207 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3211 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3214 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3220 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3225 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3226 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3230 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3237 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3244 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3248 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3249 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CF | 3250 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
CBAVD | 8 | heterozygote | varying clinical consequence - Trans |
CBAVD | 65 | heterozygote | varying clinical consequence - Trans |
CBAVD | 68 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 81 | heterozygote | varying clinical consequence - Trans |
CBAVD | 4679 | heterozygote | varying clinical consequence - Trans |
CBAVD | 4682 | heterozygote | VUS1- Undef CFTR-RD-causing- Undef |
CBAVD | 4683 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 4699 | heterozygote | CFTR-RD-causing - Trans VUS2- Undef |
CBAVD | 4703 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 4712 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 4717 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 4722 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 413 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 5072 | heterozygote | VUS3- Undef |
CBAVD | 391 | heterozygote | VUS2 - Cis CFTR-RD-causing - Trans |
CBAVD | 393 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 394 | heterozygote | varying clinical consequence - Trans |
CBAVD | 397 | heterozygote | varying clinical consequence - Trans |
CBAVD | 398 | heterozygote | varying clinical consequence - Trans |
CBAVD | 399 | heterozygote | VUS1- Undef |
CBAVD | 400 | heterozygote | varying clinical consequence - Trans VUS1- Undef |
CBAVD | 402 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 408 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 409 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 410 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 411 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 412 | heterozygote | VUS4 - Trans |
CBAVD | 414 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 420 | heterozygote | VUS4- Undef |
CBAVD | 421 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 422 | heterozygote | varying clinical consequence - Trans |
CBAVD | 425 | heterozygote | varying clinical consequence- Undef |
CBAVD | 426 | heterozygote | varying clinical consequence - Trans |
CBAVD | 428 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 432 | heterozygote | |
CBAVD | 434 | heterozygote | varying clinical consequence - Trans |
CBAVD | 435 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 436 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 437 | heterozygote | varying clinical consequence - Trans |
CBAVD | 438 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 444 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 446 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 447 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 450 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 451 | heterozygote | VUS1 - Cis VUS5 - Trans |
CBAVD | 452 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 454 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 456 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 458 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 460 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 462 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 463 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 465 | heterozygote | CFTR-RD-causing - Trans VUS4 - Trans |
CBAVD | 467 | heterozygote | varying clinical consequence- Undef |
CBAVD | 468 | heterozygote | |
CBAVD | 469 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 470 | heterozygote | varying clinical consequence - Trans VUS1 - Trans |
CBAVD | 473 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 474 | heterozygote | varying clinical consequence - Trans VUS1 - Trans |
CBAVD | 476 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 477 | heterozygote | varying clinical consequence- Undef |
CBAVD | 480 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 484 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 485 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 486 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 490 | heterozygote | varying clinical consequence- Undef |
CBAVD | 491 | heterozygote | varying clinical consequence- Undef |
CBAVD | 492 | heterozygote | varying clinical consequence- Undef |
CBAVD | 493 | heterozygote | varying clinical consequence - Trans |
CBAVD | 494 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 495 | heterozygote | VUS1 - Cis CFTR-RD-causing - Trans |
CBAVD | 498 | heterozygote | varying clinical consequence - Trans |
CBAVD | 499 | heterozygote | CFTR-RD-causing - Trans VUS1- Undef |
CBAVD | 501 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 505 | heterozygote | varying clinical consequence - Trans |
CBAVD | 506 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 514 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 515 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 517 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 519 | heterozygote | varying clinical consequence - Trans |
CBAVD | 520 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 522 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 525 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 528 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 532 | heterozygote | CFTR-RD-causing - Trans VUS1- Undef |
CBAVD | 533 | heterozygote | varying clinical consequence - Trans |
CBAVD | 535 | heterozygote | varying clinical consequence - Trans VUS1- Undef |
CBAVD | 544 | heterozygote | varying clinical consequence- Undef |
CBAVD | 548 | heterozygote | varying clinical consequence - Trans |
CBAVD | 549 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 552 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 555 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 556 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 591 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 599 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 605 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 614 | heterozygote | varying clinical consequence- Undef |
CBAVD | 619 | heterozygote | CFTR-RD-causing - Trans VUS1- Undef |
CBAVD | 632 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 647 | heterozygote | varying clinical consequence- Undef |
CBAVD | 658 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 665 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 674 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 675 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 682 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
CBAVD | 687 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 689 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 698 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 710 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 712 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 717 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 721 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 724 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 728 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 735 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 736 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 743 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 755 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 763 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
CBAVD | 765 | heterozygote | varying clinical consequence- Undef |
CBAVD | 770 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 774 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 786 | heterozygote | varying clinical consequence - Trans |
CBAVD | 792 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 810 | heterozygote | VUS2- Undef CFTR-RD-causing- Undef |
CBAVD | 819 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 825 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 832 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 834 | heterozygote | varying clinical consequence - Trans |
CBAVD | 837 | heterozygote | varying clinical consequence - Trans |
CBAVD | 838 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 840 | heterozygote | varying clinical consequence - Trans |
CBAVD | 849 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 856 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 857 | heterozygote | varying clinical consequence- Undef |
CBAVD | 859 | heterozygote | varying clinical consequence - Trans |
CBAVD | 861 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 868 | heterozygote | VUS4 - Trans |
CBAVD | 873 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 876 | heterozygote | VUS4 - Trans |
CBAVD | 890 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 891 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 893 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 895 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 900 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 904 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 912 | heterozygote | varying clinical consequence - Trans |
CBAVD | 918 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 927 | heterozygote | CFTR-RD-causing - Trans VUS4 - Trans |
CBAVD | 949 | heterozygote | VUS3- Undef |
CBAVD | 961 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 967 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 971 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 978 | heterozygote | varying clinical consequence - Trans |
CBAVD | 988 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 4828 | heterozygote | varying clinical consequence- Undef |
CBAVD | 4830 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 5223 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 5134 | heterozygote | VUS3- Undef |
CBAVD | 5221 | heterozygote | varying clinical consequence- Undef |
CBAVD | 5235 | heterozygote | VUS3 - Trans |
CBAVD | 5524 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 5821 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1048 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1055 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1056 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1065 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1067 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 5230 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 5231 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 5181 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans VUS3- Undef |
CBAVD | 5234 | heterozygote | CFTR-RD-causing - Trans VUS3- Undef |
CBAVD | 1163 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1244 | heterozygote | VUS5 - Trans |
CBAVD | 1252 | heterozygote | VUS3 - Cis CFTR-RD-causing - Trans |
CBAVD | 1263 | heterozygote | varying clinical consequence - Trans |
CBAVD | 1264 | heterozygote | varying clinical consequence - Trans |
CBAVD | 1267 | heterozygote | varying clinical consequence - Trans |
CBAVD | 1268 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 1269 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 1270 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1272 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 1274 | heterozygote | varying clinical consequence - Trans |
CBAVD | 1284 | heterozygote | VUS3- Undef |
CBAVD | 1288 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1291 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1301 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1314 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1316 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1318 | heterozygote | varying clinical consequence - Trans |
CBAVD | 1321 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1322 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1323 | heterozygote | VUS4- Undef |
CBAVD | 1326 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1327 | heterozygote | VUS2 - Cis varying clinical consequence - Trans |
CBAVD | 1333 | heterozygote | varying clinical consequence - Trans |
CBAVD | 1336 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1337 | heterozygote | VUS4 - Trans |
CBAVD | 1338 | heterozygote | |
CBAVD | 1341 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1342 | heterozygote | VUS3- Undef |
CBAVD | 1346 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1347 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1348 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1349 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1350 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1351 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 1357 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1358 | heterozygote | |
CBAVD | 1359 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1360 | heterozygote | |
CBAVD | 1361 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1362 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1365 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 1366 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 1367 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1369 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1372 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1374 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 1375 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1376 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1377 | heterozygote | VUS4- Undef |
CBAVD | 1379 | heterozygote | VUS4- Undef |
CBAVD | 1380 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1382 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1383 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1385 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1389 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 1391 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1395 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1396 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1397 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1398 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1399 | heterozygote | VUS4 - Trans CFTR-RD-causing - Trans |
CBAVD | 1400 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1402 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1403 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1404 | heterozygote | varying clinical consequence - Trans |
CBAVD | 1406 | heterozygote | VUS3- Undef |
CBAVD | 1407 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1408 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1409 | heterozygote | VUS2- Undef |
CBAVD | 1411 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1414 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1415 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1416 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1417 | heterozygote | varying clinical consequence - Trans |
CBAVD | 1418 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1420 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1421 | heterozygote | CFTR-RD-causing - Trans VUS2- Undef |
CBAVD | 1423 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 1424 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1426 | heterozygote | varying clinical consequence - Trans |
CBAVD | 1427 | heterozygote | varying clinical consequence - Trans |
CBAVD | 1428 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1429 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1432 | heterozygote | VUS3- Undef |
CBAVD | 1433 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1435 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1437 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1439 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1441 | heterozygote | varying clinical consequence - Trans |
CBAVD | 1442 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1443 | heterozygote | varying clinical consequence - Trans |
CBAVD | 1444 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1446 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1448 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1449 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1450 | heterozygote | varying clinical consequence - Trans |
CBAVD | 1451 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1452 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1458 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1459 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1460 | heterozygote | VUS4- Undef |
CBAVD | 1461 | heterozygote | VUS3 - Trans |
CBAVD | 1463 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1465 | heterozygote | CFTR-RD-causing - Trans VUS2 - Trans |
CBAVD | 1469 | heterozygote | VUS3 - Cis CFTR-RD-causing - Trans |
CBAVD | 1473 | heterozygote | VUS4- Undef |
CBAVD | 1475 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1477 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1479 | heterozygote | VUS4- Undef |
CBAVD | 1480 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1481 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 1483 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1485 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1488 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 1489 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1493 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1494 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1495 | heterozygote | VUS4- Undef |
CBAVD | 1496 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1497 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1498 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1499 | heterozygote | VUS4- Undef |
CBAVD | 1500 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1502 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1503 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 1505 | heterozygote | varying clinical consequence - Trans |
CBAVD | 1506 | heterozygote | varying clinical consequence - Trans |
CBAVD | 1508 | heterozygote | VUS3 - Trans |
CBAVD | 1510 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 1512 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 1521 | heterozygote | varying clinical consequence - Trans |
CBAVD | 1644 | heterozygote | VUS3- Undef VUS2- Undef |
CBAVD | 1668 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1672 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1674 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1680 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1724 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 1774 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 1783 | heterozygote | varying clinical consequence- Undef |
CBAVD | 4969 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 4972 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 4980 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 4981 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 4982 | heterozygote | VUS3- Undef |
CBAVD | 1796 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1798 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1818 | heterozygote | VUS3- Undef |
CBAVD | 5025 | heterozygote | VUS3- Undef |
CBAVD | 5471 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 5095 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1860 | heterozygote | CF-causing- Undef |
CBAVD | 1864 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1891 | heterozygote | VUS3- Undef |
CBAVD | 1893 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 1908 | heterozygote | varying clinical consequence - Trans VUS1 - Trans |
CBAVD | 5375 | heterozygote | varying clinical consequence - Trans |
CBAVD | 5387 | heterozygote | VUS3- Undef |
CBAVD | 5393 | heterozygote | varying clinical consequence- Undef |
CBAVD | 5398 | heterozygote | varying clinical consequence- Undef |
CBAVD | 5444 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 5451 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 5457 | heterozygote | VUS3- Undef |
CBAVD | 5460 | heterozygote | VUS2 - Cis VUS3 - Cis CFTR-RD-causing - Trans |
CBAVD | 5463 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
CBAVD | 5673 | heterozygote | CF-causing- Undef |
CBAVD | 5704 | heterozygote | varying clinical consequence- Undef |
CBAVD | 5882 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
CBAVD | 5889 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 1930 | heterozygote | VUS1- Undef varying clinical consequence- Undef |
CBAVD | 1962 | heterozygote | VUS3- Undef |
CBAVD | 1967 | heterozygote | VUS3- Undef |
CBAVD | 1969 | heterozygote | VUS1- Undef varying clinical consequence- Undef |
CBAVD | 1972 | heterozygote | VUS3 - Trans |
CBAVD | 2004 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 2009 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2014 | heterozygote | varying clinical consequence- Undef |
CBAVD | 2025 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 2032 | heterozygote | varying clinical consequence- Undef |
CBAVD | 2037 | heterozygote | |
CBAVD | 2039 | heterozygote | VUS3- Undef |
CBAVD | 2060 | heterozygote | varying clinical consequence - Trans |
CBAVD | 2078 | heterozygote | VUS3- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 2101 | heterozygote | VUS5- Undef |
CBAVD | 2114 | heterozygote | varying clinical consequence - Trans |
CBAVD | 2119 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 2120 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2134 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2141 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 2203 | heterozygote | varying clinical consequence- Undef |
CBAVD | 2221 | heterozygote | varying clinical consequence- Undef |
CBAVD | 2232 | heterozygote | varying clinical consequence - Trans |
CBAVD | 2258 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2261 | heterozygote | varying clinical consequence- Undef VUS1- Undef |
CBAVD | 2263 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 2264 | heterozygote | varying clinical consequence- Undef |
CBAVD | 2265 | heterozygote | VUS4- Undef |
CBAVD | 2292 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2337 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2390 | heterozygote | |
CBAVD | 2398 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2421 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 2449 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 2485 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef VUS1- Undef |
CBAVD | 2512 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2514 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2516 | heterozygote | varying clinical consequence- Undef |
CBAVD | 2525 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 2531 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2551 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 2556 | heterozygote | VUS4- Undef |
CBAVD | 2562 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 2565 | heterozygote | |
CBAVD | 4877 | heterozygote | varying clinical consequence - Trans |
CBAVD | 2594 | heterozygote | varying clinical consequence- Undef VUS1- Undef |
CBAVD | 4881 | heterozygote | VUS3- Undef |
CBAVD | 4886 | heterozygote | VUS3- Undef |
CBAVD | 4911 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 4919 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 4921 | heterozygote | varying clinical consequence - Trans |
CBAVD | 4922 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 4935 | heterozygote | varying clinical consequence- Undef |
CBAVD | 4944 | heterozygote | varying clinical consequence- Undef |
CBAVD | 4949 | heterozygote | varying clinical consequence- Undef |
CBAVD | 2638 | heterozygote | VUS2- Undef VUS2- Undef |
CBAVD | 2663 | heterozygote | VUS4- Undef |
CBAVD | 2664 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 2681 | heterozygote | VUS4- Undef |
CBAVD | 2683 | heterozygote | varying clinical consequence - Trans |
CBAVD | 2693 | heterozygote | VUS1 - Cis CFTR-RD-causing- Undef |
CBAVD | 2695 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2700 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 2704 | heterozygote | |
CBAVD | 2709 | heterozygote | varying clinical consequence- Undef |
CBAVD | 2714 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 2718 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2734 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 2743 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2756 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 2757 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 2759 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 3063 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2784 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2794 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2803 | heterozygote | |
CBAVD | 2806 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 2816 | heterozygote | varying clinical consequence - Trans |
CBAVD | 2817 | heterozygote | varying clinical consequence- Undef |
CBAVD | 2824 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 5018 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 5019 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 2853 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
CBAVD | 4634 | heterozygote | VUS4- Undef |
CBAVD | 2869 | heterozygote | VUS2- Undef |
CBAVD | 4622 | heterozygote | varying clinical consequence - Trans |
CBAVD | 4624 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 4650 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 4756 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 4761 | heterozygote | varying clinical consequence- Undef |
CBAVD | 4752 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 4753 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 2918 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 4754 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 4755 | heterozygote | varying clinical consequence - Trans |
CBAVD | 5015 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 2948 | heterozygote | CF-causing- Undef |
CBAVD | 2949 | heterozygote | VUS1 - Cis CFTR-RD-causing - Trans |
CBAVD | 2976 | heterozygote | varying clinical consequence - Trans VUS1- Undef |
CBAVD | 2989 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
CBAVD | 2991 | heterozygote | |
CBAVD | 3002 | heterozygote | varying clinical consequence - Trans |
CBAVD | 3003 | heterozygote | varying clinical consequence - Trans |
CBAVD | 5068 | heterozygote | varying clinical consequence - Trans VUS3- Undef |
CBAVD | 3051 | heterozygote | |
CBAVD | 3062 | heterozygote | varying clinical consequence - Trans |
CBAVD | 3064 | heterozygote | VUS3 - Trans |
CBAVD | 3100 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3125 | heterozygote | varying clinical consequence - Trans VUS1- Undef |
CBAVD | 3160 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 3201 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3208 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 3241 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 3264 | heterozygote | varying clinical consequence- Undef |
CBAVD | 3265 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3266 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 3267 | heterozygote | VUS3 - Trans |
CBAVD | 3270 | heterozygote | varying clinical consequence- Undef |
CBAVD | 3272 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3273 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 3276 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3280 | heterozygote | varying clinical consequence- Undef |
CBAVD | 3281 | heterozygote | varying clinical consequence- Undef |
CBAVD | 3286 | heterozygote | VUS3 - Trans |
CBAVD | 3288 | heterozygote | VUS1 - Trans VUS3 - Trans |
CBAVD | 3290 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3291 | heterozygote | varying clinical consequence - Trans |
CBAVD | 3292 | heterozygote | varying clinical consequence- Undef |
CBAVD | 3293 | heterozygote | varying clinical consequence - Trans |
CBAVD | 3300 | heterozygote | VUS5 - Trans |
CBAVD | 3301 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3305 | heterozygote | VUS4 - Trans |
CBAVD | 3307 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3314 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 3316 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 3317 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3322 | heterozygote | varying clinical consequence - Trans |
CBAVD | 3323 | heterozygote | varying clinical consequence - Trans |
CBAVD | 3324 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
CBAVD | 3325 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3327 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3329 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3331 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3335 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
CBAVD | 3338 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3339 | heterozygote | VUS2- Undef |
CBAVD | 3344 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3346 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 3351 | heterozygote | varying clinical consequence- Undef |
CBAVD | 3352 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3354 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 3360 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3361 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 3362 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 3364 | heterozygote | |
CBAVD | 3365 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3366 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 3369 | heterozygote | varying clinical consequence - Trans VUS1 - Trans |
CBAVD | 3370 | heterozygote | VUS4- Undef |
CBAVD | 3372 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3375 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3377 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3382 | heterozygote | VUS4- Undef |
CBAVD | 3387 | heterozygote | VUS4- Undef |
CBAVD | 3388 | heterozygote | VUS3 - Trans |
CBAVD | 3390 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 3391 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 3392 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 3394 | heterozygote | CFTR-RD-causing - Trans varying clinical consequence - Trans |
CBAVD | 3395 | heterozygote | VUS4- Undef |
CBAVD | 3396 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3401 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 3415 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 5176 | heterozygote | varying clinical consequence- Undef |
CBAVD | 5330 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 5173 | heterozygote | VUS1 - Cis varying clinical consequence - Trans |
CBAVD | 5344 | heterozygote | CF-causing- Undef |
CBAVD | 5346 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 5590 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
CBAVD | 5944 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 5968 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 5969 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 5764 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 5603 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 5610 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
CBAVD | 5943 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 5946 | heterozygote | VUS3- Undef |
CBAVD | 5947 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 5594 | heterozygote | varying clinical consequence- Undef |
CBAVD | 5565 | heterozygote | CFTR-RD-causing - Trans varying clinical consequence- Undef |
CBAVD | 4223 | heterozygote | varying clinical consequence- Undef |
CBAVD | 4238 | heterozygote | VUS4- Undef |
CBAVD | 4239 | heterozygote | VUS4- Undef |
CBAVD | 4247 | heterozygote | CFTR-RD-causing- Undef VUS4- Undef |
CBAVD | 4248 | heterozygote | CFTR-RD-causing- Undef VUS4- Undef |
CBAVD | 4264 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 4279 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 4310 | heterozygote | |
CBAVD | 4311 | heterozygote | varying clinical consequence- Undef |
CBAVD | 4313 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 4331 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
CBAVD | 4414 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 4415 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 4416 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 4419 | heterozygote | varying clinical consequence- Undef |
CBAVD | 4472 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 4503 | heterozygote | VUS2- Undef |
CBAVD | 4524 | heterozygote | VUS1- Undef |
CBAVD | 4529 | heterozygote | VUS2- Undef VUS4- Undef |
CBAVD | 4531 | heterozygote | VUS1- Undef |
CBAVD | 4556 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 4566 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 4571 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 4575 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 4578 | heterozygote | CFTR-RD-causing - Trans |
CBAVD | 4584 | heterozygote | varying clinical consequence- Undef |
CBAVD | 4598 | heterozygote | VUS1- Undef VUS2- Undef |
CBAVD | 4612 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
CBAVD | 5063 | heterozygote | VUS3- Undef |
CBAVD | 5995 | heterozygote | CF-causing - Trans |
Bronchiectasis | 4678 | heterozygote | varying clinical consequence - Trans |
Bronchiectasis | 4725 | heterozygote | VUS5- Undef |
Bronchiectasis | 4734 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 4833 | heterozygote | CFTR-RD-causing- Undef |
Bronchiectasis | 560 | heterozygote | CFTR-RD-causing- Undef |
Bronchiectasis | 850 | heterozygote | varying clinical consequence - Trans |
Bronchiectasis | 879 | heterozygote | CFTR-RD-causing- Undef |
Bronchiectasis | 899 | heterozygote | |
Bronchiectasis | 921 | heterozygote | VUS3 - Trans |
Bronchiectasis | 962 | heterozygote | VUS2 - Trans varying clinical consequence - Trans |
Bronchiectasis | 5137 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 5824 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 5826 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 4773 | heterozygote | CFTR-RD-causing - Trans VUS1- Undef VUS3- Undef |
Bronchiectasis | 1068 | heterozygote | VUS5 - Trans |
Bronchiectasis | 5200 | heterozygote | VUS5 - Trans VUS3- Undef |
Bronchiectasis | 5182 | heterozygote | varying clinical consequence- Undef VUS3- Undef |
Bronchiectasis | 1078 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 1088 | heterozygote | varying clinical consequence - Trans |
Bronchiectasis | 1090 | heterozygote | VUS1 - Cis varying clinical consequence - Trans |
Bronchiectasis | 1096 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 1117 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 1197 | heterozygote | |
Bronchiectasis | 4848 | heterozygote | varying clinical consequence - Trans |
Bronchiectasis | 4863 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 4857 | heterozygote | CF-causing - Trans |
Bronchiectasis | 5849 | heterozygote | varying clinical consequence - Trans |
Bronchiectasis | 1542 | heterozygote | CFTR-RD-causing - Trans |
Bronchiectasis | 1631 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 1752 | heterozygote | VUS3- Undef |
Bronchiectasis | 4984 | heterozygote | CFTR-RD-causing- Undef |
Bronchiectasis | 5000 | heterozygote | CFTR-RD-causing - Trans |
Bronchiectasis | 5043 | heterozygote | VUS4- Undef |
Bronchiectasis | 1829 | heterozygote | VUS3- Undef |
Bronchiectasis | 1844 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
Bronchiectasis | 5103 | heterozygote | VUS1- Undef |
Bronchiectasis | 5111 | heterozygote | CFTR-RD-causing- Undef |
Bronchiectasis | 1866 | heterozygote | VUS1- Undef |
Bronchiectasis | 1902 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 1905 | heterozygote | VUS4- Undef |
Bronchiectasis | 5706 | heterozygote | VUS4- Undef |
Bronchiectasis | 5873 | heterozygote | VUS1- Undef |
Bronchiectasis | 5887 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 2055 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 2118 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 2139 | heterozygote | VUS3- Undef |
Bronchiectasis | 2243 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
Bronchiectasis | 2254 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 2287 | heterozygote | VUS3- Undef |
Bronchiectasis | 2304 | heterozygote | |
Bronchiectasis | 2307 | heterozygote | |
Bronchiectasis | 2356 | heterozygote | VUS1 - Cis |
Bronchiectasis | 2358 | heterozygote | |
Bronchiectasis | 2368 | heterozygote | CFTR-RD-causing - Trans |
Bronchiectasis | 2409 | heterozygote | VUS3- Undef |
Bronchiectasis | 2415 | heterozygote | |
Bronchiectasis | 2420 | heterozygote | CFTR-RD-causing- Undef |
Bronchiectasis | 2440 | heterozygote | |
Bronchiectasis | 2453 | heterozygote | |
Bronchiectasis | 2454 | heterozygote | |
Bronchiectasis | 2492 | heterozygote | |
Bronchiectasis | 2522 | heterozygote | VUS1- Undef |
Bronchiectasis | 2526 | heterozygote | VUS1 - Trans |
Bronchiectasis | 2539 | heterozygote | |
Bronchiectasis | 2590 | heterozygote | VUS4- Undef |
Bronchiectasis | 4947 | heterozygote | CFTR-RD-causing- Undef |
Bronchiectasis | 2677 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 3269 | heterozygote | VUS2- Undef |
Bronchiectasis | 4623 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 4657 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 5005 | heterozygote | CFTR-RD-causing- Undef |
Bronchiectasis | 5170 | heterozygote | varying clinical consequence - Trans |
Bronchiectasis | 5950 | heterozygote | VUS3- Undef |
Bronchiectasis | 5952 | heterozygote | CFTR-RD-causing - Trans |
Bronchiectasis | 5564 | heterozygote | VUS4 - Cis CFTR-RD-causing - Trans |
Bronchiectasis | 3698 | heterozygote | CFTR-RD-causing- Undef |
Bronchiectasis | 4295 | heterozygote | |
Bronchiectasis | 4314 | heterozygote | |
Bronchiectasis | 4321 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 4421 | heterozygote | varying clinical consequence - Trans |
Bronchiectasis | 4604 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 4607 | heterozygote | varying clinical consequence- Undef |
Bronchiectasis | 4608 | heterozygote | VUS5 - Trans |
Bronchiectasis | 6200 | heterozygote | VUS2- Undef |
Bronchiectasis | 6167 | heterozygote | CF-causing - Trans |
Bronchiectasis | 5283 | heterozygote | varying clinical consequence - Trans |
Bronchiectasis | 6115 | heterozygote | CF-causing- Undef |
Pancreatitis | 76 | heterozygote | CFTR-RD-causing - Trans |
Pancreatitis | 80 | heterozygote | CFTR-RD-causing - Trans |
Pancreatitis | 4721 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 205 | heterozygote | CFTR-RD-causing - Trans |
Pancreatitis | 669 | heterozygote | |
Pancreatitis | 776 | heterozygote | varying clinical consequence - Trans |
Pancreatitis | 5145 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 5142 | heterozygote | VUS3- Undef |
Pancreatitis | 4789 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 1063 | heterozygote | varying clinical consequence - Trans |
Pancreatitis | 1161 | heterozygote | VUS1 - Cis |
Pancreatitis | 1597 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 1632 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 1669 | heterozygote | VUS1- Undef |
Pancreatitis | 1703 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 1712 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 1735 | heterozygote | CFTR-RD-causing - Trans |
Pancreatitis | 5029 | heterozygote | VUS3- Undef |
Pancreatitis | 1832 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 1836 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 5108 | heterozygote | VUS4- Undef |
Pancreatitis | 1862 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 5452 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 5453 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 5454 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 5739 | heterozygote | VUS1 - Trans |
Pancreatitis | 5741 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 5877 | heterozygote | VUS2- Undef |
Pancreatitis | 5892 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 1980 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 1981 | heterozygote | VUS1- Undef |
Pancreatitis | 2000 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 2067 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 2091 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 2204 | heterozygote | VUS4- Undef |
Pancreatitis | 2252 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 2314 | heterozygote | |
Pancreatitis | 2473 | heterozygote | VUS3- Undef |
Pancreatitis | 2476 | heterozygote | |
Pancreatitis | 2490 | heterozygote | VUS1- Undef |
Pancreatitis | 2511 | heterozygote | |
Pancreatitis | 4876 | heterozygote | VUS4 - Trans |
Pancreatitis | 4907 | heterozygote | VUS3- Undef |
Pancreatitis | 2617 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 2623 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 5179 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 2786 | heterozygote | CFTR-RD-causing - Trans |
Pancreatitis | 2860 | heterozygote | VUS4 - Trans |
Pancreatitis | 3024 | heterozygote | CFTR-RD-causing - Trans |
Pancreatitis | 4635 | heterozygote | VUS4- Undef |
Pancreatitis | 3253 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 4636 | heterozygote | VUS3 - Trans |
Pancreatitis | 4743 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 5007 | heterozygote | VUS3- Undef |
Pancreatitis | 5326 | heterozygote | CFTR-RD-causing - Trans varying clinical consequence - Trans |
Pancreatitis | 5949 | heterozygote | varying clinical consequence - Trans VUS1 - Trans VUS3- Undef |
Pancreatitis | 5569 | heterozygote | VUS3 - Trans |
Pancreatitis | 5160 | heterozygote | varying clinical consequence - Trans VUS3- Undef |
Pancreatitis | 4226 | heterozygote | VUS1- Undef |
Pancreatitis | 4240 | heterozygote | VUS1 - Cis CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
Pancreatitis | 4241 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 4261 | heterozygote | VUS4- Undef |
Pancreatitis | 4270 | heterozygote | varying clinical consequence - Trans |
Pancreatitis | 4299 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 4815 | heterozygote | CF-causing - Trans |
Pancreatitis | 4559 | heterozygote | VUS3 - Trans |
Pancreatitis | 4581 | heterozygote | VUS3- Undef |
Pancreatitis | 6199 | heterozygote | CFTR-RD-causing - Trans |
Pancreatitis | 6198 | heterozygote | CFTR-RD-causing - Trans |
Pancreatitis | 6183 | heterozygote | CFTR-RD-causing - Trans varying clinical consequence - Trans |
CRS-NP | 5531 | heterozygote | CFTR-RD-causing - Trans VUS3 - Trans |
CRS-NP | 1220 | heterozygote | CF-causing- Undef |
CRS-NP | 1239 | heterozygote | |
CRS-NP | 5762 | heterozygote | VUS3 - Trans |
CRS-NP | 5761 | heterozygote | VUS3 - Trans |
CRS-NP | 2189 | heterozygote | VUS3- Undef |
CRS-NP | 2917 | heterozygote | CFTR-RD-causing - Trans |
CRS-NP | 3043 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
CRS-NP | 3088 | heterozygote | CFTR-RD-causing - Trans |
CRS-NP | 4649 | heterozygote | varying clinical consequence - Trans |
CRS-NP | 3161 | heterozygote | varying clinical consequence - Trans VUS1- Undef |
CRS-NP | 4319 | heterozygote | CFTR-RD-causing - Trans |
CRS-NP | 4513 | heterozygote | varying clinical consequence - Trans |
CRS-NP | 6196 | heterozygote | varying clinical consequence- Undef |
CRS-NP | 5994 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
CRS-NP | 6189 | heterozygote | varying clinical consequence- Undef |
Asymptomatic compound heterozygote | 4685 | heterozygote | CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 4839 | heterozygote | VUS2 - Trans |
Asymptomatic compound heterozygote | 370 | heterozygote | VUS2 - Trans |
Asymptomatic compound heterozygote | 459 | heterozygote | CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 496 | heterozygote | VUS1 - Cis CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 542 | heterozygote | varying clinical consequence - Trans |
Asymptomatic compound heterozygote | 766 | heterozygote | |
Asymptomatic compound heterozygote | 768 | heterozygote | CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 778 | heterozygote | CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 796 | heterozygote | VUS4 - Cis CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 925 | heterozygote | CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 932 | heterozygote | CFTR-RD-causing - Trans VUS4 - Trans |
Asymptomatic compound heterozygote | 958 | heterozygote | VUS3 - Trans |
Asymptomatic compound heterozygote | 4829 | heterozygote | VUS2- Undef |
Asymptomatic compound heterozygote | 5140 | heterozygote | VUS3 - Trans |
Asymptomatic compound heterozygote | 5279 | heterozygote | VUS3 - Trans |
Asymptomatic compound heterozygote | 5942 | heterozygote | CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 5513 | heterozygote | CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 5233 | heterozygote | CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 1529 | heterozygote | varying clinical consequence- Undef |
Asymptomatic compound heterozygote | 1574 | heterozygote | varying clinical consequence - Trans |
Asymptomatic compound heterozygote | 5376 | heterozygote | varying clinical consequence - Trans |
Asymptomatic compound heterozygote | 5695 | heterozygote | VUS2- Undef |
Asymptomatic compound heterozygote | 1935 | heterozygote | CFTR-RD-causing- Undef |
Asymptomatic compound heterozygote | 2142 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
Asymptomatic compound heterozygote | 2159 | heterozygote | VUS3- Undef |
Asymptomatic compound heterozygote | 2225 | heterozygote | VUS3- Undef |
Asymptomatic compound heterozygote | 2777 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 2819 | heterozygote | VUS2 - Trans |
Asymptomatic compound heterozygote | 2929 | heterozygote | |
Asymptomatic compound heterozygote | 2956 | heterozygote | VUS1 - Trans |
Asymptomatic compound heterozygote | 2971 | heterozygote | varying clinical consequence - Trans |
Asymptomatic compound heterozygote | 2980 | heterozygote | varying clinical consequence - Trans |
Asymptomatic compound heterozygote | 3013 | heterozygote | CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 3019 | heterozygote | CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 3031 | heterozygote | varying clinical consequence - Trans |
Asymptomatic compound heterozygote | 3032 | heterozygote | VUS1 - Trans |
Asymptomatic compound heterozygote | 4757 | heterozygote | |
Asymptomatic compound heterozygote | 4758 | heterozygote | |
Asymptomatic compound heterozygote | 3191 | heterozygote | VUS3 - Trans |
Asymptomatic compound heterozygote | 3204 | heterozygote | VUS3 - Trans |
Asymptomatic compound heterozygote | 3206 | heterozygote | VUS1 - Trans |
Asymptomatic compound heterozygote | 3238 | heterozygote | VUS2- Undef |
Asymptomatic compound heterozygote | 3257 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 4617 | heterozygote | VUS3 - Trans |
Asymptomatic compound heterozygote | 4641 | heterozygote | VUS1- Undef |
Asymptomatic compound heterozygote | 4763 | heterozygote | CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 4749 | heterozygote | CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 4742 | heterozygote | CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 5004 | heterozygote | CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 5976 | heterozygote | VUS3 - Trans |
Asymptomatic compound heterozygote | 5166 | heterozygote | varying clinical consequence - Trans |
Asymptomatic compound heterozygote | 5306 | heterozygote | CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 5596 | heterozygote | CFTR-RD-causing- Undef |
Asymptomatic compound heterozygote | 5598 | heterozygote | VUS3 - Trans |
Asymptomatic compound heterozygote | 5599 | heterozygote | VUS1 - Trans |
Asymptomatic compound heterozygote | 5601 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 5597 | heterozygote | VUS3 - Trans |
Asymptomatic compound heterozygote | 5964 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
Asymptomatic compound heterozygote | 5776 | heterozygote | VUS3 - Trans |
Asymptomatic compound heterozygote | 5309 | heterozygote | VUS4 - Trans |
Asymptomatic compound heterozygote | 5164 | heterozygote | VUS1 - Trans VUS3- Undef |
Asymptomatic compound heterozygote | 5760 | heterozygote | VUS3- Undef |
Asymptomatic compound heterozygote | 4235 | heterozygote | varying clinical consequence- Undef |
Asymptomatic compound heterozygote | 4375 | heterozygote | VUS2 - Trans |
Asymptomatic compound heterozygote | 4411 | heterozygote | VUS3 - Trans |
Asymptomatic compound heterozygote | 4564 | heterozygote | varying clinical consequence - Trans |
Asymptomatic compound heterozygote | 5240 | heterozygote | CFTR-RD-causing - Trans |
Pending | 4680 | heterozygote | varying clinical consequence - Trans |
Pending | 5216 | heterozygote | CFTR-RD-causing- Undef |
Pending | 1091 | heterozygote | varying clinical consequence - Trans |
Pending | 1181 | heterozygote | CFTR-RD-causing - Trans |
Pending | 1212 | heterozygote | varying clinical consequence - Trans |
Pending | 1586 | heterozygote | varying clinical consequence - Trans |
Pending | 1635 | heterozygote | VUS3- Undef |
Pending | 1786 | heterozygote | VUS1- Undef |
Pending | 1990 | heterozygote | CFTR-RD-causing- Undef |
Pending | 2174 | heterozygote | varying clinical consequence - Trans |
Pending | 2273 | heterozygote | VUS3 - Trans |
Pending | 2428 | heterozygote | CFTR-RD-causing- Undef |
Pending | 4945 | heterozygote | varying clinical consequence - Trans |
Pending | 2833 | heterozygote | VUS4 - Trans |
Pending | 2843 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
Pending | 2944 | heterozygote | varying clinical consequence - Trans |
Pending | 4640 | heterozygote | CFTR-RD-causing - Trans |
Pending | 3236 | heterozygote | CFTR-RD-causing - Trans |
Pending | 4748 | heterozygote | CFTR-RD-causing - Trans |
Pending | 5771 | heterozygote | CF-causing - Trans |
Pending | 5568 | heterozygote | CF-causing - Trans |
Pending | 3574 | heterozygote | varying clinical consequence - Trans |
Pending | 4078 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
Pending | 4215 | heterozygote | VUS1 - Trans |
Pending | 4229 | heterozygote | varying clinical consequence - Trans |
Pending | 4336 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
Pending | 4337 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
Pending | 4548 | heterozygote | |
Pending | 4590 | heterozygote | VUS3 - Trans |
Pending (NBS) | 4689 | heterozygote | CF-causing - Trans |
Pending (NBS) | 4694 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 4667 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 4720 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 5514 | heterozygote | VUS4 - Trans |
Pending (NBS) | 352 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 377 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 387 | heterozygote | VUS4- Undef |
Pending (NBS) | 590 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 598 | heterozygote | VUS4 - Trans |
Pending (NBS) | 644 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 646 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 726 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 734 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 748 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 775 | heterozygote | |
Pending (NBS) | 785 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 794 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 826 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 944 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 5748 | heterozygote | VUS5- Undef |
Pending (NBS) | 5520 | heterozygote | VUS3 - Trans |
Pending (NBS) | 5089 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 5244 | heterozygote | VUS1 - Trans VUS3 - Trans |
Pending (NBS) | 5254 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 5247 | heterozygote | VUS1 - Cis VUS3 - Trans VUS3 - Trans |
Pending (NBS) | 5816 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 5808 | heterozygote | VUS3 - Trans |
Pending (NBS) | 5817 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 5088 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 5219 | heterozygote | VUS4 - Trans |
Pending (NBS) | 5280 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 5852 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 5805 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 5803 | heterozygote | varying clinical consequence - Trans VUS3 - Trans |
Pending (NBS) | 4769 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 4787 | heterozygote | varying clinical consequence - Trans VUS3- Undef |
Pending (NBS) | 5183 | heterozygote | CFTR-RD-causing - Trans VUS3- Undef |
Pending (NBS) | 1070 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 5190 | heterozygote | VUS3- Undef VUS3- Undef varying clinical consequence- Undef |
Pending (NBS) | 1076 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 5359 | heterozygote | VUS3 - Trans |
Pending (NBS) | 1077 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 5202 | heterozygote | CFTR-RD-causing- Undef VUS3- Undef |
Pending (NBS) | 1087 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 1180 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 1253 | heterozygote | CFTR-RD-causing - Trans VUS3- Undef |
Pending (NBS) | 1312 | heterozygote | VUS4- Undef |
Pending (NBS) | 4852 | heterozygote | VUS3 - Trans |
Pending (NBS) | 1513 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 1514 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 1522 | heterozygote | VUS5 - Trans |
Pending (NBS) | 1530 | heterozygote | VUS4 - Trans |
Pending (NBS) | 1547 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 1563 | heterozygote | VUS3 - Trans |
Pending (NBS) | 1566 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 1575 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 1580 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 5037 | heterozygote | CFTR-RD-causing- Undef varying clinical consequence- Undef |
Pending (NBS) | 5039 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 5385 | heterozygote | VUS3 - Trans |
Pending (NBS) | 5445 | heterozygote | VUS4- Undef |
Pending (NBS) | 5446 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
Pending (NBS) | 5450 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 5881 | heterozygote | CF-causing- Undef |
Pending (NBS) | 2038 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 2520 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 4951 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 5399 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 2727 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 2875 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 2895 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 2905 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 2964 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 2970 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 3011 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 3118 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 4638 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 5017 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 4666 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 4643 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 4616 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 4620 | heterozygote | varying clinical consequence- Undef VUS3- Undef |
Pending (NBS) | 4621 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 5020 | heterozygote | VUS3 - Trans |
Pending (NBS) | 5012 | heterozygote | VUS4 - Trans |
Pending (NBS) | 4654 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 5312 | heterozygote | VUS1 - Trans VUS1 - Trans |
Pending (NBS) | 5361 | heterozygote | VUS3 - Trans |
Pending (NBS) | 5305 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 5313 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
Pending (NBS) | 5310 | heterozygote | VUS4- Undef VUS3- Undef |
Pending (NBS) | 5327 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 5566 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 5342 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 5615 | heterozygote | CF-causing - Trans |
Pending (NBS) | 5769 | heterozygote | varying clinical consequence - Trans VUS3- Undef |
Pending (NBS) | 5773 | heterozygote | VUS3 - Cis VUS3 - Trans |
Pending (NBS) | 5948 | heterozygote | CF-causing - Trans |
Pending (NBS) | 5951 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 5572 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 5573 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 3437 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 3438 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 3442 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 3453 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 3458 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 3465 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 3472 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 3477 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 3492 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 3504 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 3512 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 3540 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 3548 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 5118 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 5788 | heterozygote | VUS3 - Trans |
Pending (NBS) | 5781 | heterozygote | VUS3 - Trans |
Pending (NBS) | 3579 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 3590 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 5241 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 3598 | heterozygote | VUS5 - Trans |
Pending (NBS) | 5117 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 3628 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 3648 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 3658 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 3668 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 3672 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 5801 | heterozygote | VUS4 - Trans |
Pending (NBS) | 3707 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 3713 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 3724 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 5802 | heterozygote | non-CF - Trans |
Pending (NBS) | 3763 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 3773 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 3775 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 3787 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 3842 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 3876 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 3884 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 3905 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 3908 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 3909 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 3980 | heterozygote | |
Pending (NBS) | 3982 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 4010 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 4014 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 4019 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 5786 | heterozygote | VUS3 - Trans |
Pending (NBS) | 4119 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 4122 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 4137 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 4145 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 4146 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 4159 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 4174 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 4182 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 4202 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 4228 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 4249 | heterozygote | VUS2 - Trans |
Pending (NBS) | 4263 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 4266 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 4286 | heterozygote | VUS2 - Trans |
Pending (NBS) | 4288 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 4320 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 4407 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 4409 | heterozygote | VUS3 - Trans VUS1 - Trans |
Pending (NBS) | 4508 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 4549 | heterozygote | VUS1 - Cis VUS2 - Trans |
Pending (NBS) | 4573 | heterozygote | VUS2 - Trans |
Pending (NBS) | 4593 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
Pending (NBS) | 6039 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 6081 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 6019 | heterozygote | varying clinical consequence - Trans |
Pending (NBS) | 5996 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 6090 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
Pending (NBS) | 6092 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 6095 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 6099 | heterozygote | CF-causing- Undef |
Pending (NBS) | 6100 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 6025 | heterozygote | CFTR-RD-causing - Trans |
Pending (NBS) | 6027 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 6028 | heterozygote | varying clinical consequence- Undef |
Pending (NBS) | 6032 | heterozygote | CFTR-RD-causing- Undef |
Pending (NBS) | 6030 | heterozygote | CFTR-RD-causing - Trans |
Other | 4686 | heterozygote | VUS3 - Trans |
Other | 4676 | heterozygote | varying clinical consequence - Trans |
Other | 4690 | heterozygote | CFTR-RD-causing - Trans |
Other | 4698 | heterozygote | varying clinical consequence - Trans VUS3- Undef |
Other | 4702 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
Other | 4713 | heterozygote | CFTR-RD-causing - Trans |
Other | 4714 | heterozygote | |
Other | 4846 | heterozygote | CFTR-RD-causing- Undef |
Other | 4836 | heterozygote | VUS3 - Trans |
Other | 4844 | heterozygote | CFTR-RD-causing - Trans |
Other | 87 | heterozygote | varying clinical consequence - Trans |
Other | 186 | heterozygote | varying clinical consequence- Undef |
Other | 358 | heterozygote | CFTR-RD-causing - Trans |
Other | 645 | heterozygote | CFTR-RD-causing- Undef |
Other | 752 | heterozygote | CFTR-RD-causing - Trans |
Other | 756 | heterozygote | CFTR-RD-causing - Trans |
Other | 757 | heterozygote | varying clinical consequence- Undef |
Other | 779 | heterozygote | CFTR-RD-causing - Trans |
Other | 801 | heterozygote | varying clinical consequence - Trans |
Other | 815 | heterozygote | CFTR-RD-causing - Trans |
Other | 845 | heterozygote | |
Other | 851 | heterozygote | CFTR-RD-causing - Trans |
Other | 864 | heterozygote | VUS3 - Trans |
Other | 937 | heterozygote | CFTR-RD-causing - Trans |
Other | 940 | heterozygote | |
Other | 972 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
Other | 983 | heterozygote | CFTR-RD-causing - Trans |
Other | 5743 | heterozygote | CFTR-RD-causing - Trans VUS1- Undef |
Other | 5136 | heterozygote | VUS1- Undef |
Other | 5523 | heterozygote | CFTR-RD-causing- Undef |
Other | 5518 | heterozygote | CFTR-RD-causing- Undef |
Other | 5814 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
Other | 5823 | heterozygote | VUS3- Undef VUS1- Undef VUS1- Undef |
Other | 5825 | heterozygote | VUS3- Undef VUS1- Undef |
Other | 5128 | heterozygote | varying clinical consequence - Trans |
Other | 5810 | heterozygote | VUS5- Undef |
Other | 1024 | heterozygote | varying clinical consequence- Undef |
Other | 4770 | heterozygote | VUS1 - Trans |
Other | 4774 | heterozygote | CFTR-RD-causing - Trans |
Other | 4777 | heterozygote | VUS3 - Trans |
Other | 4799 | heterozygote | varying clinical consequence- Undef VUS3- Undef |
Other | 4792 | heterozygote | VUS1 - Trans |
Other | 4800 | heterozygote | VUS3- Undef VUS3- Undef varying clinical consequence- Undef |
Other | 1062 | heterozygote | CFTR-RD-causing - Trans |
Other | 5184 | heterozygote | varying clinical consequence - Trans VUS3- Undef VUS3- Undef |
Other | 1069 | heterozygote | VUS5 - Trans |
Other | 1082 | heterozygote | varying clinical consequence - Trans |
Other | 1098 | heterozygote | varying clinical consequence - Trans |
Other | 1099 | heterozygote | CFTR-RD-causing - Trans |
Other | 1113 | heterozygote | varying clinical consequence- Undef VUS1- Undef |
Other | 1136 | heterozygote | CFTR-RD-causing - Trans |
Other | 1141 | heterozygote | CFTR-RD-causing- Undef |
Other | 1185 | heterozygote | varying clinical consequence - Trans |
Other | 1217 | heterozygote | VUS1 - Trans |
Other | 1265 | heterozygote | |
Other | 1305 | heterozygote | VUS1- Undef |
Other | 1640 | heterozygote | VUS1- Undef CFTR-RD-causing- Undef |
Other | 1576 | heterozygote | VUS1 - Trans |
Other | 1676 | heterozygote | CFTR-RD-causing- Undef |
Other | 5381 | heterozygote | CFTR-RD-causing- Undef |
Other | 5383 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
Other | 5671 | heterozygote | varying clinical consequence - Trans |
Other | 2021 | heterozygote | varying clinical consequence- Undef |
Other | 2260 | heterozygote | varying clinical consequence- Undef |
Other | 2357 | heterozygote | |
Other | 2434 | heterozygote | CFTR-RD-causing- Undef |
Other | 2448 | heterozygote | CFTR-RD-causing - Trans |
Other | 2540 | heterozygote | varying clinical consequence - Trans |
Other | 2544 | heterozygote | varying clinical consequence - Trans |
Other | 4884 | heterozygote | VUS4- Undef |
Other | 2771 | heterozygote | CFTR-RD-causing - Trans |
Other | 4767 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
Other | 5575 | heterozygote | VUS3- Undef |
Other | 2801 | heterozygote | CFTR-RD-causing - Trans |
Other | 2874 | heterozygote | CFTR-RD-causing - Trans |
Other | 4664 | heterozygote | CFTR-RD-causing- Undef |
Other | 2952 | heterozygote | CFTR-RD-causing - Trans |
Other | 3022 | heterozygote | varying clinical consequence - Trans |
Other | 3047 | heterozygote | CFTR-RD-causing - Trans |
Other | 3058 | heterozygote | CF-causing - Trans |
Other | 3076 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
Other | 3246 | heterozygote | CFTR-RD-causing - Trans |
Other | 3247 | heterozygote | varying clinical consequence- Undef |
Other | 3397 | heterozygote | CFTR-RD-causing - Trans |
Other | 3404 | heterozygote | varying clinical consequence - Trans |
Other | 5175 | heterozygote | VUS3- Undef |
Other | 5763 | heterozygote | VUS3- Undef VUS1- Undef |
Other | 5360 | heterozygote | varying clinical consequence - Trans |
Other | 5567 | heterozygote | CFTR-RD-causing - Trans |
Other | 5625 | heterozygote | CFTR-RD-causing - Trans |
Other | 5775 | heterozygote | VUS3- Undef VUS3- Undef |
Other | 5163 | heterozygote | VUS3- Undef |
Other | 3539 | heterozygote | CFTR-RD-causing - Trans |
Other | 3589 | heterozygote | varying clinical consequence - Trans |
Other | 3608 | heterozygote | varying clinical consequence - Trans |
Other | 5789 | heterozygote | VUS3- Undef |
Other | 3881 | heterozygote | VUS3 - Trans |
Other | 5122 | heterozygote | VUS3 - Trans |
Other | 5119 | heterozygote | varying clinical consequence- Undef |
Other | 5120 | heterozygote | varying clinical consequence - Trans |
Other | 4244 | heterozygote | varying clinical consequence - Trans |
Other | 4278 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans VUS1- Undef |
Other | 4312 | heterozygote | VUS2- Undef |
Other | 4818 | heterozygote | varying clinical consequence- Undef |
Other | 4808 | heterozygote | CF-causing- Undef |
Other | 4810 | heterozygote | CFTR-RD-causing- Undef |
Other | 4812 | heterozygote | VUS3- Undef |
Other | 4338 | heterozygote | non-CF - Trans |
Other | 4520 | heterozygote | VUS5- Undef |
Other | 4528 | heterozygote | varying clinical consequence - Trans |
Other | 4542 | heterozygote | varying clinical consequence - Trans |
Other | 4546 | heterozygote | varying clinical consequence- Undef |
Other | 4561 | heterozygote | VUS4- Undef |
Other | 4563 | heterozygote | CFTR-RD-causing - Trans VUS3- Undef |
Other | 4567 | heterozygote | VUS4- Undef |
Other | 4570 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
Other | 4600 | heterozygote | varying clinical consequence- Undef |
Other | 4615 | heterozygote | CFTR-RD-causing- Undef |
Other | 5806 | heterozygote | VUS3- Undef |
Other | 6190 | heterozygote | varying clinical consequence- Undef |
Other | 6157 | heterozygote | VUS4 - Trans |
Other | 6194 | heterozygote | VUS3 - Trans |
Other | 6187 | heterozygote | varying clinical consequence- Undef |
Other | 6114 | heterozygote | CF-causing - Trans |
Other | 6118 | heterozygote | CF-causing - Trans |
Other | 6014 | heterozygote | VUS2 - Trans |
Other | 4588 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
Pending non-CF | 4681 | heterozygote | varying clinical consequence - Trans |
Pending non-CF | 4704 | heterozygote | CFTR-RD-causing - Trans |
Pending non-CF | 4677 | heterozygote | varying clinical consequence - Trans |
Pending non-CF | 753 | heterozygote | VUS3 - Trans |
Pending non-CF | 5716 | heterozygote | VUS3 - Trans |
Pending non-CF | 5009 | heterozygote | VUS3 - Trans |
Pending non-CF | 3877 | heterozygote | VUS4 - Trans |
Pending non-CF | 5121 | heterozygote | CFTR-RD-causing- Undef |
Pending non-CF | 6000 | heterozygote | VUS3 - Trans |
Fetal bowel anomalies | 4670 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 253 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 323 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 366 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 375 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 578 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 584 | heterozygote | varying clinical consequence - Trans |
Fetal bowel anomalies | 677 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 760 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 771 | heterozygote | |
Fetal bowel anomalies | 824 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 828 | heterozygote | CFTR-RD-causing - Trans |
Fetal bowel anomalies | 874 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 880 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 917 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 923 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 5147 | heterozygote | varying clinical consequence - Trans |
Fetal bowel anomalies | 4958 | heterozygote | VUS3 - Trans |
Fetal bowel anomalies | 1234 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 1286 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 1302 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 1436 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 1565 | heterozygote | VUS2 - Trans CF-causing - Trans |
Fetal bowel anomalies | 5435 | heterozygote | VUS3 - Trans |
Fetal bowel anomalies | 5394 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 2388 | heterozygote | CF-causing- Undef |
Fetal bowel anomalies | 2487 | heterozygote | CF-causing- Undef |
Fetal bowel anomalies | 2569 | heterozygote | CF-causing- Undef |
Fetal bowel anomalies | 4948 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 2692 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 3186 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 3402 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 3403 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 5162 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 3776 | heterozygote | CF-causing- Undef |
Fetal bowel anomalies | 3865 | heterozygote | VUS3- Undef |
Fetal bowel anomalies | 4020 | heterozygote | CF-causing- Undef |
Fetal bowel anomalies | 4052 | heterozygote | CF-causing- Undef |
Fetal bowel anomalies | 4086 | heterozygote | CF-causing- Undef |
Fetal bowel anomalies | 4246 | heterozygote | VUS4 - Trans |
Fetal bowel anomalies | 4316 | heterozygote | CFTR-RD-causing - Trans |
Fetal bowel anomalies | 4324 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 4533 | heterozygote | CF-causing - Trans |
Fetal bowel anomalies | 4873 | heterozygote | VUS3 - Trans |
Fetal bowel anomalies | 5357 | heterozygote | VUS2 - Cis VUS3 - Trans |
Fetal bowel anomalies | 98 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
Fetal bowel anomalies | 871 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
Fetal bowel anomalies | 1292 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
Fetal bowel anomalies | 1564 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
Fetal bowel anomalies | 3555 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
Fetal bowel anomalies | 3809 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
Fetal bowel anomalies | 3989 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
Fetal bowel anomalies | 4064 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
Fetal bowel anomalies | 4075 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
Fetal bowel anomalies | 4109 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
Fetal bowel anomalies | 4180 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
Fetal bowel anomalies | 4265 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
Fetal bowel anomalies | 4322 | homozygote | c.1521_1523del - p.(Phe508del) - Trans |
Aquagenic palmoplantar keratoderma | 4827 | heterozygote | CFTR-RD-causing- Undef |
Aquagenic palmoplantar keratoderma | 5149 | heterozygote | VUS3- Undef |
Aquagenic palmoplantar keratoderma | 5785 | heterozygote | CFTR-RD-causing - Trans |
Color code: non disease-causing < VUS1 < VUS2 < VUS3 < VUS4 < VUS5 < disease-causing |
CFTR variants are clustered into five groups: |
|