Variant NM_000492.4:c.1523T>G
Name | NM_000492.4:c.1523T>G | ||||
Protein name | NP_000483.3:p.(Phe508Cys) | ||||
Genomic name (hg19) | chr7:g.117199648T>G UCSC gnomAD | ||||
#Exon/intron | exon 11 | ||||
Legacy Name | F508C | ||||
Class | disease-causing | ||||
Subclass | CFTR-RD-causing | ||||
complex allele in 15.56% of patients associated with WT sequence |
GGCACCATTAAAGAAAATATCATCT T TGGTGTTTCCTATGATGAATATAGA |
Mutant sequence |
GGCACCATTAAAGAAAATATCATCT G TGGTGTTTCCTATGATGAATATAGA |
|
dbSNP rs74571530 |
Reference | PMID | Splicing | mRNA level | Maturation | Localization | Channel fonction (Cl-) | Bicarbonate |
Gregory et al, 1991 | 1712898 | ✓ | ✓ |
« ✓ » indicates the type of analysis performed and not the results
Modulator | FDA approval | EMA approval | in vitro / ex vivo data | clinical data |
IVA | yes | no | yes | no |
TEZ-IVA | yes | no | yes | no |
ELX-TEZ-IVA | yes | no | yes | no |
clinical and functional data are provided by Vertex
Color code: non disease-causing < VUS1 < VUS2 < VUS3 < VUS4 < VUS5 < disease-causing |
1 individuals carrying this variant are reported in CFTR-NGS catalogue |
TOTAL NUMBER OF PATIENTS | 45 |
---|---|
Asymptomatic compound heterozygote | 3 |
CF | 8 |
CFTR-RD | 33
|
Pending (NBS) | 1 |
Phenotype | Patient ID | Variant status | Additional variants |
---|---|---|---|
CBAVD | 2531 | heterozygote | CF-causing - Trans |
CBAVD | 5451 | heterozygote | CF-causing - Trans |
CBAVD | 4624 | heterozygote | CF-causing - Trans |
CBAVD | 4753 | heterozygote | CF-causing- Undef |
CBAVD | 5968 | heterozygote | CF-causing - Trans |
CBAVD | 3396 | heterozygote | CF-causing - Trans |
CBAVD | 3344 | heterozygote | CF-causing - Trans |
CBAVD | 1871 | heterozygote | CF-causing- Undef |
CBAVD | 687 | heterozygote | CF-causing - Trans |
CBAVD | 678 | heterozygote | CF-causing- Undef |
CBAVD | 515 | heterozygote | CF-causing - Trans |
CBAVD | 453 | heterozygote | CF-causing - Trans |
CBAVD | 441 | heterozygote | VUS4 - Trans |
CBAVD | 4710 | heterozygote | VUS3- Undef CF-causing- Undef |
CBAVD | 712 | heterozygote | CF-causing - Trans |
CBAVD | 5471 | heterozygote | CF-causing - Trans |
CBAVD | 1319 | heterozygote | CF-causing- Undef |
CBAVD | 1256 | heterozygote | CF-causing- Undef VUS1- Undef |
CBAVD | 5127 | heterozygote | CF-causing- Undef |
CBAVD | 4830 | heterozygote | CF-causing - Trans |
CBAVD | 895 | heterozygote | CF-causing - Trans |
CBAVD | 810 | heterozygote | VUS2- Undef CF-causing- Undef |
CBAVD | 4669 | heterozygote | CF-causing - Trans |
Other | 4844 | heterozygote | CF-causing - Trans |
CF | 2854 | heterozygote | CF-causing - Cis CF-causing - Trans |
CF | 2850 | heterozygote | CF-causing - Cis CF-causing - Trans |
CF | 2735 | heterozygote | CF-causing - Cis CF-causing - Trans |
CF | 2343 | heterozygote | CF-causing - Trans |
CF | 2998 | heterozygote | CF-causing - Cis CF-causing - Trans |
CF | 313 | heterozygote | CF-causing - Trans varying clinical consequence- Undef |
CF | 88 | heterozygote | CF-causing - Cis CF-causing - Trans |
CF | 696 | heterozygote | CF-causing - Cis CF-causing - Trans |
Bronchiectasis | 3219 | heterozygote | VUS2- Undef |
Bronchiectasis | 2988 | heterozygote | CF-causing - Cis varying clinical consequence - Trans |
Bronchiectasis | 5530 | heterozygote | VUS3- Undef |
Asymptomatic compound heterozygote | 4303 | heterozygote | VUS2- Undef |
Asymptomatic compound heterozygote | 5306 | heterozygote | CF-causing - Trans |
Asymptomatic compound heterozygote | 5942 | heterozygote | CF-causing - Trans |
Pancreatitis | 2581 | heterozygote | |
Pancreatitis | 2521 | heterozygote | |
Pancreatitis | 2369 | heterozygote | |
Pancreatitis | 3245 | heterozygote | CF-causing - Trans |
Pancreatitis | 5097 | heterozygote | VUS3 - Trans |
Pancreatitis | 1856 | heterozygote | CF-causing- Undef |
Pending (NBS) | 5305 | heterozygote | CF-causing - Trans |
Color code: non disease-causing < VUS1 < VUS2 < VUS3 < VUS4 < VUS5 < disease-causing |
CFTR variants are clustered into five groups: |
|