Variant NM_000492.4:c.1624G>T


Variant details:
Name NM_000492.4:c.1624G>T
Protein name NP_000483.3:p.(Gly542*)
Genomic name (hg19) chr7:g.117227832G>T    UCSC    gnomAD
#Exon/intron exon 12
Legacy Name G542X
Class disease-causing
Subclass CF-causing
WT sequence TGCAGAGAAAGACAATATAGTTCTT G GAGAAGGTGGAATCACACTGAGTGG
Mutant sequence TGCAGAGAAAGACAATATAGTTCTT T GAGAAGGTGGAATCACACTGAGTGG






External sources:
dbSNP
rs113993959
Not found







3 individuals carrying this variant are reported in CFTR-NGS catalogue


228 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 228
Asymptomatic compound heterozygote 2
CF 164
CFTR-RD46
  • Bronchiectasis  3
  • CBAVD  28
  • CRS-NP  2
  • Other  9
  • Pancreatitis  4
Fetal bowel anomalies 4
Pending 2
Pending (NBS) 10



Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 3168heterozygotevarying clinical consequence - Trans
CF 2844heterozygoteCF-causing - Trans
CF 2826heterozygoteCF-causing - Trans
CF 2804heterozygoteCF-causing - Trans
CF 2802heterozygoteCF-causing- Undef
CF 2779heterozygoteCF-causing- Undef
CF 2778heterozygoteCF-causing- Undef
CF 2769heterozygoteCF-causing - Trans
CF 2763heterozygoteCF-causing - Trans
CF 2691heterozygotevarying clinical consequence - Trans
CF 2865heterozygoteCF-causing - Trans
CF 3124heterozygoteCF-causing- Undef
CF 3099heterozygotevarying clinical consequence - Trans
CF 3071heterozygoteCF-causing - Trans
CF 3027heterozygoteCF-causing - Trans
CF 3004heterozygoteCF-causing - Trans
CF 2977heterozygoteCF-causing - Trans
CF 2973heterozygoteCF-causing - Trans
CF 2955heterozygoteCF-causing - Trans
CF 2687heterozygoteCF-causing - Trans
CF 2606heterozygoteCF-causing- Undef
CF 2124heterozygoteCF-causing- Undef
CF 2097heterozygoteCF-causing- Undef
CF 2062heterozygoteCF-causing- Undef
CF 2059heterozygotevarying clinical consequence- Undef
CF 2042heterozygoteCF-causing- Undef
CF 2035heterozygoteCF-causing- Undef
CF 1997heterozygoteCF-causing- Undef
CF 1955heterozygoteCF-causing- Undef
CF 1929heterozygoteCF-causing- Undef
CF 2176heterozygoteCF-causing- Undef
CF 2197heterozygotevarying clinical consequence- Undef
CF 4912heterozygotevarying clinical consequence - Trans
CF 2561heterozygoteCF-causing- Undef
CF 2537heterozygoteCF-causing- Undef
CF 2534heterozygoteCF-causing- Undef
CF 2517heterozygoteCF-causing- Undef
CF 2458heterozygoteCF-causing- Undef
CF 2274heterozygoteCF-causing - Trans
CF 2269heterozygoteCF-causing- Undef
CF 2216heterozygoteCF-causing- Undef
CF 2205heterozygoteCF-causing- Undef
CF 1852heterozygoteCF-causing- Undef
CF 4284heterozygoteCF-causing - Trans
CF 4186heterozygoteCF-causing- Undef
CF 4157heterozygoteCF-causing- Undef
CF 4108heterozygoteCF-causing- Undef
CF 4098heterozygoteCF-causing- Undef
CF 4080heterozygoteCF-causing- Undef
CF 4051heterozygoteCF-causing - Trans
CF 4047heterozygoteCF-causing- Undef
CF 4005heterozygoteCF-causing- Undef
CF 4545heterozygoteCF-causing - Trans
CF 4518heterozygotevarying clinical consequence - Trans
CF 4514heterozygoteCF-causing - Trans
CF 4489heterozygotevarying clinical consequence - Trans
CF 4486heterozygotevarying clinical consequence - Trans
CF 4396heterozygoteCF-causing- Undef
CF 4368heterozygoteCF-causing - Trans
CF 4357heterozygoteCF-causing- Undef
CF 4003heterozygoteCF-causing - Trans
CF 3990heterozygoteCF-causing - Trans
CF 3620heterozygoteCF-causing- Undef
CF 3526heterozygoteCF-causing- Undef
CF 3490heterozygoteCF-causing- Undef
CF 5971heterozygoteVUS3 - Trans
CF 3419heterozygoteCF-causing - Trans
CF 3407heterozygoteCF-causing - Trans
CF 3328heterozygoteCF-causing - Trans
CF 3621heterozygoteCF-causing- Undef
CF 3664heterozygoteCF-causing- Undef
CF 3988heterozygoteCF-causing - Trans
CF 3966heterozygoteCF-causing- Undef
CF 3930heterozygoteCF-causing- Undef
CF 3915heterozygoteCF-causing- Undef
CF 3830heterozygoteCF-causing- Undef
CF 3824heterozygoteCF-causing - Trans
CF 3798heterozygoteCF-causing - Trans
CF 3778heterozygoteCF-causing - Trans
CF 3777heterozygoteCF-causing- Undef
CF 3764heterozygoteCF-causing- Undef
CF 3688heterozygoteCF-causing- Undef
CF 3682heterozygoteCF-causing- Undef
CF 3190heterozygoteCF-causing - Trans
CF 588heterozygoteCF-causing - Trans
CF 471heterozygotevarying clinical consequence- Undef
CF 390heterozygoteCF-causing - Trans
CF 356heterozygoteCF-causing - Trans
CF 594heterozygotevarying clinical consequence- Undef
CF 860heterozygoteCF-causing - Trans
VUS1 - Trans
CF 802heterozygotevarying clinical consequence- Undef
CF 798heterozygotevarying clinical consequence - Trans
CF 788heterozygotevarying clinical consequence- Undef
CF 732heterozygoteCF-causing - Trans
CF 731heterozygoteCF-causing - Trans
CF 702heterozygoteCF-causing - Trans
CF 671heterozygoteCF-causing- Undef
CF 597heterozygoteCF-causing- Undef
CF 596heterozygoteCF-causing- Undef
CF 346heterozygoteCF-causing - Trans
CF 341heterozygoteCF-causing- Undef
CF 143heterozygoteCF-causing - Trans
CF 119heterozygoteCF-causing - Trans
CF 110heterozygoteCF-causing - Trans
CF 99heterozygoteCF-causing - Trans
CF 97heterozygoteCF-causing - Trans
CF 47heterozygoteCF-causing - Trans
VUS3- Undef
CF 182heterozygoteCF-causing - Trans
CF 188heterozygoteVUS5 - Trans
CF 335heterozygoteCF-causing- Undef
CF 306heterozygoteCF-causing - Trans
CF 297heterozygoteCF-causing - Trans
non-CF - Trans
CF 274heterozygoteCF-causing - Trans
CF 263heterozygotevarying clinical consequence - Trans
CF 261heterozygoteCF-causing- Undef
CF 259heterozygoteCF-causing- Undef
CF 244heterozygoteCF-causing - Trans
CF 239heterozygoteCF-causing - Trans
CF 236heterozygoteCF-causing- Undef
CF 207heterozygotevarying clinical consequence - Trans
CF 193heterozygoteCF-causing - Trans
CF 1heterozygoteCF-causing - Trans
CF 883heterozygoteCF-causing - Trans
CF 1203heterozygoteCF-causing - Trans
CF 1201heterozygoteCF-causing - Trans
CF 1160heterozygoteCF-causing - Trans
CF 1150heterozygoteCF-causing - Trans
CF 1146heterozygoteCF-causing - Trans
CF 1131heterozygoteCF-causing - Trans
CF 1130heterozygote
CF 1119heterozygoteCF-causing- Undef
CF 1262heterozygoteCF-causing - Trans
CF 1317heterozygotevarying clinical consequence - Trans
CF 1768heterozygotevarying clinical consequence- Undef
CF 1760heterozygoteCF-causing- Undef
CF 1714heterozygoteCF-causing- Undef
CF 1700heterozygoteCF-causing- Undef
CF 1685heterozygoteCF-causing- Undef
CF 1684heterozygoteCF-causing- Undef
CF 1525heterozygoteCF-causing - Trans
CF 1095heterozygoteCF-causing - Trans
CF 4823heterozygoteCF-causing - Trans
CF 1004heterozygoteCF-causing - Trans
CF 1000heterozygoteCF-causing - Trans
CF 975heterozygoteVUS4- Undef
CF 973heterozygoteCF-causing- Undef
CF 968heterozygoteCF-causing - Trans
CF 936heterozygoteCF-causing - Trans
CF 1012heterozygoteCF-causing - Trans
CF 909heterozygotevarying clinical consequence - Trans
CF 1094heterozygoteCF-causing- Undef
CF 889heterozygoteCF-causing - Trans
CF 1050heterozygoteCF-causing- Undef
CF 1045heterozygoteCF-causing - Trans
CF 5263heterozygotevarying clinical consequence - Trans
CF 5132heterozygotevarying clinical consequence - Trans
CF 4822heterozygoteCF-causing - Trans
CF 1639homozygotec.1624G>T - p.(Gly542*) - Trans
CF 705homozygotec.1624G>T - p.(Gly542*) - Trans
CF 2229homozygotec.1624G>T - p.(Gly542*) - Trans
CF 4193homozygotec.1624G>T - p.(Gly542*) - Trans
CF 4130homozygotec.1624G>T - p.(Gly542*) - Trans
CF 4796homozygotec.*133T>A - p.(=) - Trans
c.1624G>T - p.(Gly542*) - Trans
c.54-589A>G - p.(=) - Trans
c.870-1113_870-1110del - p.(=) - Trans
CF 2670homozygotec.1624G>T - p.(Gly542*) - Trans
Pending (NBS) 2940heterozygoteVUS2 - Trans
Pending (NBS) 4920heterozygotevarying clinical consequence - Trans
Pending (NBS) 5236heterozygoteCFTR-RD-causing - Trans
Pending (NBS) 4803heterozygote
Pending (NBS) 5349heterozygotevarying clinical consequence- Undef
Pending (NBS) 52heterozygoteCFTR-RD-causing - Trans
Pending (NBS) 1114heterozygotevarying clinical consequence - Trans
Pending (NBS) 934heterozygotevarying clinical consequence - Trans
Pending (NBS) 5820heterozygoteCFTR-RD-causing - Trans
VUS3- Undef
Pending (NBS) 5533heterozygoteVUS3- Undef
Pending 53heterozygote
Pending 907heterozygoteVUS3 - Trans
Pancreatitis 5708heterozygoteCFTR-RD-causing- Undef
Pancreatitis 4687heterozygotevarying clinical consequence- Undef
Pancreatitis 70heterozygotevarying clinical consequence - Trans
Pancreatitis 1225heterozygoteVUS1 - Trans
Other 2934heterozygote
Other 4762heterozygoteVUS3- Undef
Other 4801heterozygoteCFTR-RD-causing- Undef
Other 4317heterozygote
Other 4813heterozygotevarying clinical consequence- Undef
Other 4547heterozygotevarying clinical consequence - Trans
Other 547heterozygoteCFTR-RD-causing - Trans
Other 4715heterozygoteCFTR-RD-causing - Trans
Other 980heterozygoteCFTR-RD-causing - Trans
varying clinical consequence - Trans
CBAVD 2822heterozygoteCFTR-RD-causing- Undef
CBAVD 2820heterozygoteVUS4- Undef
CBAVD 2730heterozygoteCFTR-RD-causing- Undef
CBAVD 4651heterozygoteVUS3- Undef
VUS1- Undef
CBAVD 2165heterozygoteCFTR-RD-causing- Undef
CBAVD 1968heterozygotevarying clinical consequence- Undef
CBAVD 4562heterozygotevarying clinical consequence - Trans
CBAVD 4534heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5765heterozygotevarying clinical consequence- Undef
VUS3- Undef
CBAVD 3416heterozygotevarying clinical consequence- Undef
CBAVD 3376heterozygotevarying clinical consequence - Trans
CBAVD 3279heterozygoteCFTR-RD-causing- Undef
CBAVD 875heterozygoteVUS4- Undef
CBAVD 553heterozygoteCFTR-RD-causing- Undef
CBAVD 541heterozygotevarying clinical consequence - Trans
CBAVD 534heterozygoteCFTR-RD-causing - Trans
CBAVD 497heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 483heterozygoteCFTR-RD-causing- Undef
CBAVD 430heterozygoteCFTR-RD-causing - Trans
CFTR-RD-causing - Trans
CFTR-RD-causing - Trans
CBAVD 589heterozygotevarying clinical consequence- Undef
CBAVD 679heterozygoteCFTR-RD-causing - Trans
CBAVD 678heterozygoteCFTR-RD-causing- Undef
CBAVD 4740heterozygoteVUS1- Undef
CBAVD 1250heterozygoteCFTR-RD-causing- Undef
CBAVD 1746heterozygoteCFTR-RD-causing- Undef
CBAVD 1425heterozygoteCFTR-RD-causing - Trans
CBAVD 1329heterozygotevarying clinical consequence- Undef
CBAVD 1066heterozygotevarying clinical consequence- Undef
Fetal bowel anomalies 367heterozygoteCF-causing - Trans
Fetal bowel anomalies 1286heterozygoteCF-causing - Trans
Fetal bowel anomalies 2487heterozygoteCF-causing- Undef
Fetal bowel anomalies 4324heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 885heterozygoteVUS1 - Trans
Asymptomatic compound heterozygote 4961heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CRS-NP 910heterozygote
CRS-NP 3078heterozygoteVUS3 - Trans
Bronchiectasis 4601heterozygoteCFTR-RD-causing - Trans
Bronchiectasis 1792heterozygoteVUS1- Undef
Bronchiectasis 4866heterozygoteCFTR-RD-causing- Undef


Color code:   non disease-causing <   VUS1 <   VUS2 <   VUS3 <   VUS4 <   VUS5 <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare