Variant NM_000492.4:c.1652G>A


Variant details:
Name NM_000492.4:c.1652G>A
Protein name NP_000483.3:p.(Gly551Asp)
Genomic name (hg19) chr7:g.117227860G>A    UCSC    gnomAD
#Exon/intron exon 12
Legacy Name G551D
Class disease-causing
Subclass CF-causing
WT sequence GAAGGTGGAATCACACTGAGTGGAG G TCAACGAGCAAGAATTTCTTTAGCA
Mutant sequence GAAGGTGGAATCACACTGAGTGGAG A TCAACGAGCAAGAATTTCTTTAGCA


External sources:
dbSNP
rs75527207


Functional studies:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Gregory et al, 1991 1712898 ✓ ✓
Yu et al, 2012 22293084 ✓ ✓ ✓
Sosnay et al, 2013 23974870 ✓ ✓
Bergougnoux et al, 2015 25797027 ✓


« ✓ » indicates the type of analysis performed and not the results


Response to modulators:


Modulator FDA approval EMA approval in vitro / ex vivo data clinical data
IVA yes yesno yes
TEZ-IVA yesnoyesno
ELX-TEZ-IVA yesnoyesno


clinical and functional data are provided by Vertex


Pathogenicity predictions:
AGVGD MAPP SIFT PPH2
C65 1e-05 0 1
VUS5 VUS5 VUS5 VUS5

Color code:   non disease-causing <   VUS1 <   VUS2 <   VUS3 <   VUS4 <   VUS5 <   disease-causing




3 individuals carrying this variant are reported in CFTR-NGS catalogue


95 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 95
Asymptomatic compound heterozygote 3
CF 73
CFTR-RD10
  • Bronchiectasis  1
  • CBAVD  4
  • Other  3
  • Pancreatitis  2
Pending 3
Pending (NBS) 6



Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CBAVD 4706heterozygoteCFTR-RD-causing- Undef
CBAVD 1378heterozygoteCFTR-RD-causing - Trans
CBAVD 1478heterozygoteVUS4- Undef
CBAVD 2353heterozygotevarying clinical consequence- Undef
Pending (NBS) 3676heterozygotevarying clinical consequence - Trans
Pending (NBS) 3655heterozygotevarying clinical consequence - Trans
Pending (NBS) 4030heterozygoteCFTR-RD-causing - Trans
Pending (NBS) 3958heterozygoteVUS5 - Trans
Pending (NBS) 4821heterozygotevarying clinical consequence - Trans
Pending (NBS) 562heterozygoteVUS3 - Trans
CF 3431heterozygoteCF-causing- Undef
CF 3661heterozygoteCF-causing- Undef
CF 3717heterozygoteCF-causing- Undef
CF 3739heterozygoteCF-causing - Trans
CF 3770heterozygoteCF-causing- Undef
CF 3777heterozygoteCF-causing- Undef
CF 3792heterozygoteCF-causing - Trans
CF 3803heterozygoteCF-causing - Trans
CF 3858heterozygoteCF-causing- Undef
CF 3656heterozygoteCF-causing- Undef
CF 3653heterozygoteCF-causing- Undef
CF 3470heterozygoteCF-causing- Undef
CF 3493heterozygoteCF-causing- Undef
CF 3506heterozygoteCF-causing- Undef
CF 3524heterozygoteCF-causing- Undef
CF 3564heterozygoteCF-causing- Undef
CF 3565heterozygoteCF-causing- Undef
CF 3575heterozygoteCF-causing - Trans
CF 3576heterozygoteCF-causing- Undef
CF 3585heterozygoteCF-causing - Trans
CF 3861heterozygoteCF-causing- Undef
CF 3875heterozygoteCF-causing - Trans
CF 4090heterozygoteCF-causing- Undef
CF 4091heterozygoteCF-causing - Trans
CF 4166heterozygotevarying clinical consequence- Undef
CF 4189heterozygoteCF-causing- Undef
CF 5783heterozygotevarying clinical consequence - Trans
CF 4427heterozygoteCF-causing - Trans
CF 4434heterozygoteCF-causing - Trans
CF 4056heterozygoteCF-causing- Undef
CF 4050heterozygoteCF-causing- Undef
CF 3892heterozygoteCF-causing- Undef
CF 3904heterozygoteCF-causing- Undef
CF 3912heterozygoteCF-causing - Trans
CF 3936heterozygoteCF-causing- Undef
CF 3937heterozygoteCF-causing- Undef
CF 3944heterozygoteCF-causing- Undef
CF 3951heterozygoteCF-causing- Undef
CF 3995heterozygoteCF-causing - Trans
CF 4510heterozygoteCF-causing - Trans
CF 4780heterozygoteCF-causing - Trans
CF 1164heterozygoteCF-causing - Trans
CF 1201heterozygoteCF-causing - Trans
CF 1303heterozygoteCF-causing- Undef
CF 1608heterozygoteCF-causing- Undef
CF 1622heterozygoteCF-causing- Undef
CF 5512heterozygoteCF-causing - Trans
CF 183heterozygoteCF-causing - Trans
CF 242heterozygoteCF-causing- Undef
CF 365heterozygoteCF-causing - Trans
CF 368heterozygoteCF-causing - Trans
CF 729heterozygoteCF-causing - Trans
CF 956heterozygoteCF-causing - Trans
CF 1623heterozygoteCF-causing- Undef
CF 1677heterozygoteCF-causing- Undef
CF 2589heterozygoteCF-causing- Undef
CF 2598heterozygoteCF-causing- Undef
CF 2729heterozygotevarying clinical consequence- Undef
CF 2773heterozygoteCF-causing - Trans
CF 2810heterozygoteCF-causing - Trans
CF 3005heterozygoteCF-causing - Trans
CF 3120heterozygoteCFTR-RD-causing- Undef
CF 5777heterozygoteVUS3 - Trans
VUS3 - Trans
CF 2426heterozygotevarying clinical consequence- Undef
CF 4988heterozygoteCFTR-RD-causing- Undef
CF 1889heterozygoteCF-causing- Undef
CF 1903heterozygoteCF-causing- Undef
CF 1994heterozygoteCF-causing- Undef
CF 2250heterozygoteCF-causing- Undef
CF 3570homozygotec.1652G>A - p.(Gly551Asp) - Trans
CF 4408homozygotec.1652G>A - p.(Gly551Asp) - Trans
CF 1820homozygotec.1652G>A - p.(Gly551Asp) - Trans
CF 3591homozygotec.1652G>A - p.(Gly551Asp) - Trans
Asymptomatic compound heterozygote 385heterozygoteVUS3 - Trans
Asymptomatic compound heterozygote 574heterozygoteVUS3 - Trans
Asymptomatic compound heterozygote 3148heterozygoteVUS2 - Trans
Other 4458heterozygoteCFTR-RD-causing - Trans
CFTR-RD-causing - Trans
Other 1283heterozygoteCFTR-RD-causing- Undef
Other 5522heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 1237heterozygoteCFTR-RD-causing- Undef
Pancreatitis 4890heterozygotevarying clinical consequence- Undef
Pancreatitis 5371heterozygoteVUS2- Undef
Pending 4505heterozygoteCFTR-RD-causing - Trans
CFTR-RD-causing - Trans
Pending 2447heterozygotevarying clinical consequence- Undef
Pending 5868heterozygotevarying clinical consequence- Undef


Color code:   non disease-causing <   VUS1 <   VUS2 <   VUS3 <   VUS4 <   VUS5 <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.