Variant NM_000492.4:c.3140-92T>C


Variant details:
Name NM_000492.4:c.3140-92T>C
Protein name NP_000483.3:p.(=)
Genomic name (hg19) chr7:g.117251543T>C    UCSC    gnomAD
#Exon/intron intron 19
Legacy Name 3272-93T/C
Class non disease-causing
WT sequence ACCAATGACATTTGTGATATGATTA T TCTAATTTAGTCTTTTTCAGGTACA
Mutant sequence ACCAATGACATTTGTGATATGATTA C TCTAATTTAGTCTTTTTCAGGTACA






External sources:

Not found		dbSNP
rs4148717
Not found







3 individuals carrying this variant are reported in CFTR-NGS catalogue


37 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 37
CF 6
CFTR-RD30
  • Bronchiectasis  3
  • CBAVD  13
  • Other  5
  • Pancreatitis  9
Pending (NBS) 1



Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CBAVD 4729heterozygoteVUS3- Undef
VUS5- Undef
CBAVD 4646heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 5343heterozygoteVUS3- Undef
VUS3- Undef
CBAVD 5314heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5946heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 2504heterozygotevarying clinical consequence- Undef
CF-causing- Undef
VUS1- Undef
CBAVD 2437heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 720heterozygoteCFTR-RD-causing- Undef
CBAVD 868heterozygoteCF-causing- Undef
VUS4- Undef
CBAVD 927heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS4- Undef
CBAVD 1052heterozygotevarying clinical consequence- Undef
varying clinical consequence- Undef
CBAVD 2292heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 1659heterozygoteVUS3- Undef
Bronchiectasis 5331heterozygoteVUS5- Undef
Bronchiectasis 5074heterozygoteVUS3 - Cis
VUS3 - Trans
Bronchiectasis 1068heterozygoteCF-causing- Undef
VUS5- Undef
Pancreatitis 3182heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 5010heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 5611heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 5617heterozygoteVUS3- Undef
Pancreatitis 2326heterozygoteVUS3- Undef
Pancreatitis 669heterozygoteCF-causing- Undef
Pancreatitis 1920heterozygoteVUS3- Undef
Pancreatitis 5974homozygotec.2145A>C - p.(Gln715His) - Trans
Pancreatitis 5165homozygotec.2502T>G - p.(Phe834Leu) - Trans
c.3718-79T>C - p.(=) - Trans
CF 3200heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4744heterozygoteCF-causing- Undef
VUS3- Undef
CF 5770heterozygoteVUS3- Undef
CF-causing- Undef
CF 1178heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1126homozygotec.3189G>A - p.(Trp1063*) - Trans
CF 977homozygotec.680T>G - p.(Leu227Arg) - Trans
Other 5175heterozygoteCF-causing- Undef
VUS3- Undef
Other 5775heterozygoteCF-causing- Undef
VUS3- Undef
VUS3- Undef
Other 4539heterozygoteVUS2- Undef
VUS3- Undef
VUS1- Undef
Other 1069heterozygoteCF-causing- Undef
VUS5- Undef
Other 5187heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 5609heterozygoteVUS3- Undef
CF-causing- Undef


Color code:   non disease-causing <   VUS1 <   VUS2 <   VUS3 <   VUS4 <   VUS5 <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare