Variant NM_000492.4:c.3454G>C
Name | NM_000492.4:c.3454G>C |
Protein name | NP_000483.3:p.(Asp1152His) |
Genomic name (hg19) | chr7:g.117254753G>C UCSC gnomAD |
#Exon/intron | exon 21 |
Legacy Name | D1152H |
Class | disease-causing |
Subclass | varying clinical consequence |
WT sequence | GCAGTGGGCTGTAAACTCCAGCATA G ATGTGGATAGCTTGGTAAGTCTTAT |
Mutant sequence | GCAGTGGGCTGTAAACTCCAGCATA C ATGTGGATAGCTTGGTAAGTCTTAT |
dbSNP rs75541969 |
Reference | PMID | Splicing | mRNA level | Maturation | Localization | Channel fonction (Cl-) | Bicarbonate |
Vankeerberghen et al, 1998 | 9804160 | ✓ | ✓ | ||||
Caputo et al, 2009 | 19491324 | ✓ | ✓ | ||||
Van Goor et al, 2014 | 23891399 | ✓ | ✓ | ✓ | |||
Sosnay et al, 2013 | 23974870 | ✓ | ✓ | ||||
LaRusch et al, 2014 | 25033378 | ✓ | ✓ | ✓ |
« ✓ » indicates the type of analysis performed and not the results
Modulator | FDA approval | EMA approval | in vitro / ex vivo data | clinical data |
IVA | yes | no | no | yes |
TEZ-IVA | yes | yes | no | yes |
ELX-TEZ-IVA | yes | no | yes | no |
clinical and functional data are provided by Vertex
Color code: non disease-causing < VUS1 < VUS2 < VUS3 < VUS4 < VUS5 < disease-causing |
3 individuals carrying this variant are reported in CFTR-NGS catalogue |
TOTAL NUMBER OF PATIENTS | 116 |
---|---|
Asymptomatic compound heterozygote | 4 |
CF | 31 |
CFTR-RD | 72
|
Pending | 3 |
Pending (NBS) | 6 |
Phenotype | Patient ID | Variant status | Additional variants |
---|---|---|---|
CBAVD | 1968 | heterozygote | CF-causing- Undef |
CBAVD | 2202 | heterozygote | CF-causing- Undef |
CBAVD | 1668 | heterozygote | CF-causing- Undef |
CBAVD | 1783 | heterozygote | CF-causing- Undef |
CBAVD | 5047 | heterozygote | varying clinical consequence- Undef |
CBAVD | 5095 | heterozygote | CF-causing- Undef |
CBAVD | 5398 | heterozygote | CF-causing- Undef |
CBAVD | 5459 | heterozygote | varying clinical consequence - Trans |
CBAVD | 4271 | heterozygote | CF-causing- Undef |
CBAVD | 4562 | heterozygote | CF-causing - Trans |
CBAVD | 4595 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 5593 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 2713 | heterozygote | CF-causing- Undef |
CBAVD | 2747 | heterozygote | varying clinical consequence- Undef |
CBAVD | 3281 | heterozygote | CF-causing- Undef |
CBAVD | 3309 | heterozygote | CF-causing- Undef |
CBAVD | 3311 | heterozygote | varying clinical consequence- Undef |
CBAVD | 8 | heterozygote | CF-causing - Trans |
CBAVD | 492 | heterozygote | CF-causing- Undef |
CBAVD | 498 | heterozygote | CF-causing - Trans |
CBAVD | 541 | heterozygote | CF-causing - Trans |
CBAVD | 544 | heterozygote | CF-causing- Undef |
CBAVD | 612 | heterozygote | CF-causing- Undef |
CBAVD | 697 | heterozygote | CFTR-RD-causing - Trans CFTR-RD-causing - Trans CFTR-RD-causing - Trans |
CBAVD | 737 | heterozygote | CF-causing- Undef |
CBAVD | 897 | heterozygote | CF-causing- Undef |
CBAVD | 990 | heterozygote | CF-causing- Undef |
CBAVD | 477 | heterozygote | CF-causing- Undef |
CBAVD | 448 | heterozygote | CF-causing- Undef |
CBAVD | 4696 | heterozygote | CF-causing- Undef |
CBAVD | 416 | heterozygote | CF-causing- Undef |
CBAVD | 418 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 425 | heterozygote | CF-causing- Undef |
CBAVD | 437 | heterozygote | CF-causing - Trans |
CBAVD | 1401 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 1454 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 1490 | heterozygote | VUS3 - Trans VUS1 - Trans |
CBAVD | 1497 | heterozygote | CF-causing- Undef |
CBAVD | 1509 | heterozygote | VUS4- Undef |
CBAVD | 1521 | heterozygote | CF-causing - Trans |
CBAVD | 1616 | heterozygote | varying clinical consequence- Undef |
CBAVD | 1368 | heterozygote | CFTR-RD-causing- Undef |
CBAVD | 1263 | heterozygote | CF-causing - Trans |
CBAVD | 1314 | heterozygote | CF-causing- Undef |
Bronchiectasis | 2022 | heterozygote | CF-causing - Trans |
Bronchiectasis | 5887 | heterozygote | CF-causing- Undef |
Bronchiectasis | 5112 | heterozygote | CF-causing- Undef |
Bronchiectasis | 4604 | heterozygote | CF-causing- Undef |
Bronchiectasis | 3213 | heterozygote | CF-causing - Trans CFTR-RD-causing - Trans |
Bronchiectasis | 4607 | heterozygote | CF-causing- Undef |
Bronchiectasis | 4678 | heterozygote | CF-causing - Trans |
Bronchiectasis | 5182 | heterozygote | CF-causing- Undef VUS3- Undef |
Bronchiectasis | 1117 | heterozygote | CF-causing- Undef |
Bronchiectasis | 4863 | heterozygote | CF-causing- Undef |
Bronchiectasis | 5707 | homozygote | c.3454G>C - p.(Asp1152His) - Trans |
Pancreatitis | 2110 | heterozygote | CFTR-RD-causing - Trans |
Pancreatitis | 4890 | heterozygote | CF-causing- Undef |
Pancreatitis | 5698 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 4976 | heterozygote | varying clinical consequence- Undef |
Pancreatitis | 4692 | heterozygote | CFTR-RD-causing- Undef |
Pancreatitis | 1662 | heterozygote | CF-causing- Undef |
Pancreatitis | 5696 | homozygote | c.3454G>C - p.(Asp1152His) - Trans |
CRS-NP | 4733 | heterozygote | CF-causing- Undef |
CRS-NP | 5537 | heterozygote | CFTR-RD-causing- Undef |
CF | 1667 | heterozygote | CF-causing- Undef |
CF | 2015 | heterozygote | CF-causing- Undef |
CF | 2023 | heterozygote | CF-causing- Undef |
CF | 2088 | heterozygote | CF-causing- Undef |
CF | 2121 | heterozygote | CF-causing- Undef |
CF | 2426 | heterozygote | CF-causing- Undef |
CF | 1728 | heterozygote | CF-causing- Undef |
CF | 1729 | heterozygote | CF-causing- Undef |
CF | 4999 | heterozygote | CF-causing- Undef |
CF | 4895 | heterozygote | CF-causing- Undef |
CF | 4923 | heterozygote | CF-causing- Undef |
CF | 4035 | heterozygote | CF-causing- Undef |
CF | 4128 | heterozygote | CF-causing - Trans |
CF | 4133 | heterozygote | CF-causing - Trans |
CF | 4605 | heterozygote | CF-causing - Trans |
CF | 4924 | heterozygote | CF-causing - Trans |
CF | 4952 | heterozygote | CF-causing- Undef |
CF | 2842 | heterozygote | CF-causing - Trans |
CF | 579 | heterozygote | CF-causing - Trans |
CF | 600 | heterozygote | CF-causing- Undef |
CF | 787 | heterozygote | CF-causing - Trans |
CF | 488 | heterozygote | CF-causing - Trans |
CF | 238 | heterozygote | CF-causing - Trans |
CF | 249 | heterozygote | CF-causing - Trans |
CF | 264 | heterozygote | CF-causing- Undef |
CF | 1543 | heterozygote | CF-causing- Undef |
CF | 1545 | heterozygote | CF-causing - Trans |
CF | 1628 | heterozygote | CF-causing- Undef |
CF | 1259 | heterozygote | CF-causing- Undef |
CF | 1279 | heterozygote | CF-causing - Trans |
CF | 4864 | heterozygote | CF-causing- Undef |
Other | 2260 | heterozygote | CF-causing- Undef |
Other | 5369 | heterozygote | CF-causing- Undef |
Other | 4542 | heterozygote | CF-causing - Trans |
Other | 4600 | heterozygote | CF-causing- Undef |
Other | 315 | heterozygote | VUS3- Undef |
Other | 4799 | heterozygote | CF-causing- Undef VUS3- Undef |
Other | 1082 | heterozygote | CF-causing - Trans |
Aquagenic palmoplantar keratoderma | 5365 | heterozygote | VUS3- Undef VUS3- Undef |
Pending (NBS) | 4920 | heterozygote | CF-causing - Trans |
Pending (NBS) | 3876 | heterozygote | CF-causing- Undef |
Pending (NBS) | 3492 | heterozygote | CF-causing- Undef |
Pending (NBS) | 5805 | heterozygote | CF-causing - Trans |
Pending (NBS) | 1566 | heterozygote | CF-causing - Trans |
Pending (NBS) | 1114 | heterozygote | CF-causing - Trans |
Pending | 1212 | heterozygote | CF-causing - Trans |
Pending | 2132 | heterozygote | varying clinical consequence - Trans |
Pending | 2944 | heterozygote | CF-causing - Trans |
Asymptomatic compound heterozygote | 4564 | heterozygote | CF-causing - Trans |
Asymptomatic compound heterozygote | 2808 | heterozygote | CFTR-RD-causing- Undef CFTR-RD-causing- Undef |
Asymptomatic compound heterozygote | 2971 | heterozygote | CF-causing - Trans |
Asymptomatic compound heterozygote | 1574 | heterozygote | CF-causing - Trans |
Color code: non disease-causing < VUS1 < VUS2 < VUS3 < VUS4 < VUS5 < disease-causing |
CFTR variants are clustered into five groups: |
|