Variant NM_000492.4:c.350G>A


Variant details:
Name NM_000492.4:c.350G>A
Protein name NP_000483.3:p.(Arg117His)
Genomic name (hg19) chr7:g.117171029G>A    UCSC    gnomAD
#Exon/intron exon 4
Legacy Name R117H
Class disease-causing
Subclass CFTR-RD-causing
WT sequence TATGACCCGGATAACAAGGAGGAAC G CTCTATCGCGATTTATCTAGGCATA
Mutant sequence TATGACCCGGATAACAAGGAGGAAC A CTCTATCGCGATTTATCTAGGCATA


External sources:
dbSNP
rs78655421


Functional studies:


Reference PMID Splicing mRNA level Maturation Localization Channel fonction (Cl-) Bicarbonate
Sheppard et al, 1993 7680769 ✓ ✓ ✓
Hammerle et al, 2001 11278813 ✓ ✓ ✓
Van Goor et al, 2014 23891399 ✓ ✓ ✓
Sosnay et al, 2013 23974870 ✓ ✓
LaRusch et al, 2014 25033378 ✓ ✓ ✓
Bergougnoux et al, 2015 25797027 ✓ ✓ ✓


« ✓ » indicates the type of analysis performed and not the results




Pathogenicity predictions:
AGVGD MAPP SIFT PPH2
C0 0.828 0.04 1
VUS1 VUS1 VUS5 VUS5

Color code:   non disease-causing <   VUS1 <   VUS2 <   VUS3 <   VUS4 <   VUS5 <   disease-causing




5 individuals carrying this variant are reported in CFTR-NGS catalogue


215 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 215
Asymptomatic compound heterozygote 11
CF 4
CFTR-RD143
  • Aquagenic palmoplantar keratoderma  1
  • Bronchiectasis  8
  • CBAVD  95
  • CRS-NP  1
  • Other  26
  • Pancreatitis  12
Fetal bowel anomalies 1
Pending 3
Pending (NBS) 52
Pending non-CF 1



Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
Pending (NBS) 5566heterozygoteCF-causing - Trans
Pending (NBS) 4616heterozygoteCF-causing - Trans
Pending (NBS) 3135heterozygoteCF-causing - Trans
Pending (NBS) 2877heterozygoteVUS2 - Trans
Pending (NBS) 4182heterozygoteCF-causing - Trans
Pending (NBS) 4159heterozygoteCF-causing - Trans
Pending (NBS) 4146heterozygoteCF-causing- Undef
Pending (NBS) 4122heterozygoteCF-causing- Undef
Pending (NBS) 4119heterozygoteCF-causing - Trans
Pending (NBS) 4113heterozygoteCF-causing- Undef
Pending (NBS) 4030heterozygoteCF-causing - Trans
Pending (NBS) 4019heterozygoteCF-causing- Undef
Pending (NBS) 4010heterozygoteCF-causing - Trans
Pending (NBS) 3982heterozygoteCF-causing- Undef
Pending (NBS) 4263heterozygoteCF-causing - Trans
Pending (NBS) 4555heterozygoteCF-causing- Undef
Pending (NBS) 4420heterozygoteCFTR-RD-causing - Trans
CFTR-RD-causing - Trans
Pending (NBS) 4410heterozygoteCF-causing - Trans
Pending (NBS) 3909heterozygoteCF-causing- Undef
Pending (NBS) 3905heterozygoteCF-causing- Undef
Pending (NBS) 3787heterozygoteCF-causing - Trans
Pending (NBS) 3477heterozygoteCF-causing- Undef
Pending (NBS) 3472heterozygoteCF-causing- Undef
Pending (NBS) 3458heterozygoteCF-causing - Trans
Pending (NBS) 3442heterozygoteCF-causing- Undef
Pending (NBS) 3437heterozygoteCF-causing - Trans
Pending (NBS) 5573heterozygoteCF-causing - Trans
Pending (NBS) 5570heterozygoteCF-causing - Trans
Pending (NBS) 3478heterozygoteCF-causing - Trans
VUS3- Undef
Pending (NBS) 3504heterozygoteCF-causing- Undef
Pending (NBS) 3775heterozygoteCF-causing - Trans
Pending (NBS) 3773heterozygoteCF-causing- Undef
Pending (NBS) 3672heterozygoteCF-causing - Trans
Pending (NBS) 3668heterozygoteCF-causing - Trans
Pending (NBS) 3663heterozygoteCF-causing - Trans
Pending (NBS) 3648heterozygoteCF-causing - Trans
Pending (NBS) 3590heterozygoteCF-causing- Undef
Pending (NBS) 3579heterozygoteCF-causing- Undef
Pending (NBS) 3512heterozygoteCF-causing- Undef
Pending (NBS) 944heterozygoteCF-causing - Trans
Pending (NBS) 785heterozygoteCF-causing - Trans
Pending (NBS) 769heterozygoteCFTR-RD-causing - Trans
Pending (NBS) 5254heterozygoteCF-causing - Trans
Pending (NBS) 644heterozygoteCF-causing - Trans
Pending (NBS) 52heterozygoteCF-causing - Trans
Pending (NBS) 2212heterozygotevarying clinical consequence- Undef
Pending (NBS) 2183heterozygoteCF-causing- Undef
Pending (NBS) 1514heterozygoteCF-causing - Trans
Pending (NBS) 1513heterozygoteCF-causing - Trans
Pending (NBS) 3667homozygotec.350G>A - p.(Arg117His) - Trans
Pending (NBS) 4123homozygotec.350G>A - p.(Arg117His) - Trans
Pending (NBS) 566homozygotec.350G>A - p.(Arg117His) - Trans
Pancreatitis 4642heterozygoteCF-causing- Undef
Pancreatitis 5154heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Pancreatitis 4743heterozygoteCF-causing- Undef
Pancreatitis 3163heterozygotevarying clinical consequence - Trans
Pancreatitis 2811heterozygote
Pancreatitis 2591heterozygoteVUS3- Undef
Pancreatitis 2907heterozygote
Pancreatitis 4318heterozygoteCFTR-RD-causing- Undef
Pancreatitis 4692heterozygotevarying clinical consequence- Undef
Pancreatitis 5708heterozygoteCF-causing- Undef
Pancreatitis 5397heterozygoteCF-causing- Undef
Pancreatitis 1961heterozygote
CBAVD 3334heterozygotevarying clinical consequence - Trans
VUS1 - Trans
CBAVD 3331heterozygoteCF-causing - Trans
CBAVD 3321heterozygote
CBAVD 3279heterozygoteCF-causing- Undef
CBAVD 3273heterozygoteCF-causing- Undef
CBAVD 3266heterozygoteCF-causing- Undef
CBAVD 3265heterozygoteCF-causing - Trans
CBAVD 3241heterozygoteCF-causing- Undef
CBAVD 3343heterozygoteCF-causing- Undef
CBAVD 3355heterozygoteCF-causing- Undef
CBAVD 3415heterozygoteCF-causing - Trans
CBAVD 3391heterozygoteCF-causing- Undef
CBAVD 4750heterozygoteCF-causing- Undef
CBAVD 3381heterozygotevarying clinical consequence- Undef
CBAVD 3374heterozygotevarying clinical consequence- Undef
CBAVD 3372heterozygoteCF-causing - Trans
CBAVD 3371heterozygoteVUS5 - Trans
CBAVD 2742heterozygoteCF-causing - Trans
CBAVD 2734heterozygoteCF-causing- Undef
CBAVD 2714heterozygoteCF-causing- Undef
CBAVD 2700heterozygoteCF-causing- Undef
CBAVD 2693heterozygoteCF-causing- Undef
VUS1- Undef
CBAVD 2609heterozygoteVUS1- Undef
CBAVD 4929heterozygoteVUS3 - Cis
varying clinical consequence - Trans
CBAVD 2885heterozygoteCFTR-RD-causing- Undef
CBAVD 2481heterozygote
CBAVD 4597heterozygotevarying clinical consequence- Undef
CBAVD 4576heterozygoteVUS3- Undef
CBAVD 4575heterozygoteCF-causing- Undef
CBAVD 4472heterozygoteCF-causing- Undef
CBAVD 5945heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 5766heterozygotevarying clinical consequence - Trans
VUS3- Undef
CBAVD 5281heterozygoteCFTR-RD-causing - Trans
CBAVD 1364heterozygoteCF-causing - Trans
CBAVD 931heterozygoteCF-causing - Trans
CBAVD 893heterozygoteCF-causing - Trans
CBAVD 832heterozygoteCF-causing - Trans
CBAVD 1362heterozygoteCF-causing - Trans
CBAVD 1361heterozygoteCF-causing - Trans
CBAVD 1347heterozygoteCF-causing - Trans
CBAVD 1341heterozygoteCF-causing - Trans
CBAVD 4850heterozygoteCFTR-RD-causing - Trans
CBAVD 1268heterozygoteCF-causing- Undef
CBAVD 1030heterozygotevarying clinical consequence- Undef
CBAVD 506heterozygoteCF-causing- Undef
CBAVD 479heterozygoteCF-causing- Undef
CBAVD 478heterozygoteCF-causing- Undef
CBAVD 438heterozygoteCF-causing - Trans
CBAVD 427heterozygoteCF-causing- Undef
CBAVD 409heterozygoteCF-causing- Undef
CBAVD 403heterozygoteVUS1 - Trans
CF-causing - Trans
CBAVD 4724heterozygoteCF-causing- Undef
CBAVD 512heterozygoteCFTR-RD-causing - Trans
CBAVD 520heterozygoteCF-causing- Undef
CBAVD 728heterozygoteCF-causing- Undef
CBAVD 724heterozygoteCF-causing - Trans
CBAVD 721heterozygoteCF-causing - Trans
CBAVD 717heterozygoteCF-causing - Trans
CBAVD 675heterozygoteCF-causing- Undef
CBAVD 650heterozygoteCF-causing- Undef
CBAVD 640heterozygoteCF-causing- Undef
CBAVD 633heterozygoteCF-causing- Undef
CBAVD 5874heterozygoteVUS3- Undef
CBAVD 5665heterozygoteCFTR-RD-causing - Trans
CFTR-RD-causing - Trans
CFTR-RD-causing - Trans
CBAVD 1893heterozygoteCF-causing- Undef
CBAVD 4979heterozygoteCF-causing- Undef
CBAVD 1774heterozygoteCF-causing- Undef
CBAVD 2336heterozygoteCFTR-RD-causing- Undef
CBAVD 2263heterozygoteCF-causing- Undef
CBAVD 2208heterozygoteCF-causing- Undef
CBAVD 2025heterozygoteCF-causing- Undef
CBAVD 2004heterozygoteCF-causing- Undef
CBAVD 1979heterozygotevarying clinical consequence- Undef
CBAVD 1745heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 1437heterozygoteCF-causing - Trans
CBAVD 1435heterozygoteCF-causing - Trans
CBAVD 1433heterozygoteCF-causing - Trans
CBAVD 1430heterozygoteCF-causing - Trans
CBAVD 1429heterozygoteCF-causing - Trans
CBAVD 1425heterozygoteCF-causing - Trans
CBAVD 1419heterozygoteCFTR-RD-causing- Undef
CBAVD 1397heterozygoteCF-causing - Trans
CBAVD 1394heterozygoteVUS3 - Trans
CBAVD 1393heterozygoteCFTR-RD-causing- Undef
CBAVD 1378heterozygoteCF-causing - Trans
CBAVD 1372heterozygoteCF-causing - Trans
CBAVD 1439heterozygoteCF-causing - Trans
CBAVD 1467heterozygoteCF-causing - Trans
CBAVD 1470heterozygoteCF-causing - Trans
CBAVD 1504heterozygotevarying clinical consequence- Undef
CBAVD 1496heterozygoteCF-causing - Trans
CBAVD 1482heterozygotevarying clinical consequence- Undef
CBAVD 1480heterozygoteCF-causing - Trans
CBAVD 1475heterozygoteCF-causing - Trans
CBAVD 701homozygotec.350G>A - p.(Arg117His) - Trans
Asymptomatic compound heterozygote 3019heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 4259heterozygoteVUS3- Undef
Asymptomatic compound heterozygote 4260heterozygoteCFTR-RD-causing - Trans
CFTR-RD-causing - Trans
CFTR-RD-causing - Trans
Asymptomatic compound heterozygote 5333heterozygoteVUS5 - Trans
Asymptomatic compound heterozygote 925heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 778heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 959heterozygoteVUS3 - Trans
Asymptomatic compound heterozygote 768heterozygoteCF-causing - Trans
Asymptomatic compound heterozygote 4955heterozygoteCFTR-RD-causing - Trans
Asymptomatic compound heterozygote 4736heterozygoteVUS3 - Trans
Asymptomatic compound heterozygote 2383heterozygoteCF-causing- Undef
Fetal bowel anomalies 621heterozygoteVUS1 - Trans
Bronchiectasis 5005heterozygoteCF-causing- Undef
Bronchiectasis 2502heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Bronchiectasis 2960heterozygote
Bronchiectasis 3698heterozygoteCF-causing- Undef
Bronchiectasis 693heterozygoteCF-causing - Trans
VUS1- Undef
Bronchiectasis 2344heterozygote
Bronchiectasis 5000heterozygoteCF-causing - Trans
Bronchiectasis 2280heterozygoteCF-causing- Undef
Other 3246heterozygoteCF-causing - Trans
Other 3397heterozygoteCF-causing - Trans
Other 3233heterozygoteCF-causing - Trans
Other 3167heterozygoteCF-causing - Trans
Other 4927heterozygotevarying clinical consequence- Undef
Other 2829heterozygoteCF-causing - Trans
Other 2834heterozygoteCF-causing - Trans
Other 3141heterozygoteCF-causing - Trans
Other 2906heterozygotevarying clinical consequence - Trans
Other 2874heterozygoteCF-causing - Trans
Other 4810heterozygoteCF-causing- Undef
Other 4801heterozygoteCF-causing- Undef
Other 4292heterozygoteCF-causing - Trans
Other 5625heterozygoteCF-causing - Trans
Other 5567heterozygoteCF-causing - Trans
Other 877heterozygoteCF-causing - Trans
Other 815heterozygoteCF-causing - Trans
Other 789heterozygoteCF-causing- Undef
Other 983heterozygoteCF-causing - Trans
Other 1184heterozygotevarying clinical consequence- Undef
Other 1158heterozygoteCF-causing- Undef
Other 1141heterozygoteCF-causing- Undef
Other 752heterozygoteCF-causing - Trans
Other 5666heterozygoteVUS3- Undef
Other 1676heterozygoteCF-causing- Undef
Other 1640heterozygoteCF-causing- Undef
VUS1- Undef
Pending 1544heterozygoteCF-causing - Trans
Pending 1990heterozygoteCF-causing- Undef
Pending 2428heterozygoteCF-causing- Undef
CF 4418heterozygoteCFTR-RD-causing - Cis
CF-causing - Trans
VUS3- Undef
CF 4973heterozygoteCF-causing- Undef
CF 2182heterozygoteCF-causing- Undef
CF 1562heterozygoteCF-causing - Trans
Aquagenic palmoplantar keratoderma 5702heterozygoteVUS3- Undef
CRS-NP 3088heterozygoteCF-causing - Trans
Pending non-CF 3094heterozygotevarying clinical consequence - Trans


Color code:   non disease-causing <   VUS1 <   VUS2 <   VUS3 <   VUS4 <   VUS5 <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.