Variant NM_000492.4:c.3846G>A


Variant details:
Name NM_000492.4:c.3846G>A
Protein name NP_000483.3:p.(Trp1282*)
Genomic name (hg19) chr7:g.117282620G>A    UCSC    gnomAD
#Exon/intron exon 23
Legacy Name W1282X
Class disease-causing
Subclass CF-causing
WT sequence GGGATTCAATAACTTTGCAACAGTG G AGGAAAGCCTTTGGAGTGATACCAC
Mutant sequence GGGATTCAATAACTTTGCAACAGTG A AGGAAAGCCTTTGGAGTGATACCAC






External sources:
dbSNP
rs77010898

Not found







2 individuals carrying this variant are reported in CFTR-NGS catalogue


83 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 83
Asymptomatic compound heterozygote 1
CF 57
CFTR-RD21
  • Bronchiectasis  3
  • CBAVD  17
  • Pancreatitis  1
Fetal bowel anomalies 2
Pending (NBS) 2



Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 2192heterozygoteCF-causing- Undef
CF 2227heterozygoteCF-causing- Undef
CF 2257heterozygoteCF-causing- Undef
CF 2444heterozygoteCF-causing- Undef
CF 4899heterozygotevarying clinical consequence - Trans
CF 2607heterozygoteCF-causing- Undef
CF 2172heterozygoteCF-causing- Undef
CF 2170heterozygoteCF-causing- Undef
CF 1936heterozygoteCF-causing- Undef
CF 1939heterozygoteCF-causing- Undef
CF 1963heterozygoteCF-causing- Undef
CF 1978heterozygoteCF-causing- Undef
CF 2015heterozygotevarying clinical consequence- Undef
CF 2051heterozygoteCF-causing- Undef
CF 2109heterozygotevarying clinical consequence- Undef
CF 4939heterozygoteCF-causing- Undef
CF 2642heterozygoteCF-causing- Undef
CF 3615heterozygoteCF-causing- Undef
CF 3630heterozygoteCF-causing - Trans
CF 3680heterozygoteCF-causing- Undef
CF 3798heterozygoteCF-causing - Trans
CF 3834heterozygoteCF-causing- Undef
CF 4136heterozygoteCF-causing- Undef
CF 3513heterozygoteCF-causing- Undef
CF 5341heterozygoteVUS3 - Trans
VUS3- Undef
CF 5014heterozygoteCF-causing - Cis
CF-causing - Trans
CF 2947heterozygoteCF-causing - Trans
CF 3053heterozygoteCF-causing - Trans
CF 3055heterozygoteCF-causing - Trans
CF 5011heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1293heterozygotevarying clinical consequence- Undef
CF 1289heterozygoteCF-causing- Undef
CF 1005heterozygoteCF-causing - Trans
CF 985heterozygoteCF-causing - Trans
CF 911heterozygotevarying clinical consequence - Trans
CF 655heterozygoteCF-causing- Undef
CF 631heterozygoteCF-causing - Trans
CF 579heterozygotevarying clinical consequence - Trans
CF 145heterozygoteCF-causing - Trans
CF 138heterozygoteCF-causing - Trans
CF 69heterozygoteCF-causing - Trans
CF 1883heterozygoteCF-causing- Undef
CF 5094heterozygoteCF-causing - Trans
CF 1857heterozygoteCF-causing- Undef
CF 1814heterozygoteCF-causing- Undef
CF 1665heterozygoteCF-causing- Undef
CF 1904heterozygoteCF-causing- Undef
CF 1006heterozygoteCF-causing - Trans
CF 1600heterozygoteCF-causing- Undef
CF 1606heterozygoteCF-causing- Undef
CF 2244homozygotec.3846G>A - p.(Trp1282*) - Trans
CF 2061homozygotec.3846G>A - p.(Trp1282*) - Trans
CF 26homozygotec.3846G>A - p.(Trp1282*) - Trans
CF 136homozygotec.3846G>A - p.(Trp1282*) - Trans
CF 1887homozygotec.3846G>A - p.(Trp1282*) - Trans
CF 28homozygotec.3846G>A - p.(Trp1282*) - Trans
CF 2188homozygotec.3846G>A - p.(Trp1282*) - Trans
CBAVD 6175heterozygoteCFTR-RD-causing - Trans
VUS4 - Trans
CBAVD 2202heterozygotevarying clinical consequence- Undef
CBAVD 2564heterozygoteCFTR-RD-causing- Undef
CBAVD 2713heterozygotevarying clinical consequence- Undef
CBAVD 3363heterozygoteCFTR-RD-causing - Trans
CBAVD 3368heterozygoteCFTR-RD-causing- Undef
CBAVD 5871heterozygoteCFTR-RD-causing- Undef
CBAVD 1328heterozygoteCFTR-RD-causing- Undef
CBAVD 919heterozygoteVUS3- Undef
VUS1- Undef
CBAVD 737heterozygotevarying clinical consequence- Undef
CBAVD 725heterozygoteVUS3- Undef
VUS1- Undef
CBAVD 416heterozygotevarying clinical consequence- Undef
CBAVD 1331heterozygoteCFTR-RD-causing- Undef
CBAVD 1332heterozygotevarying clinical consequence- Undef
CBAVD 1663heterozygotevarying clinical consequence- Undef
CBAVD 1466heterozygoteVUS4- Undef
CBAVD 1491heterozygoteVUS3 - Trans
VUS1 - Trans
Pending (NBS) 6003heterozygoteCFTR-RD-causing- Undef
Pending (NBS) 5356heterozygoteVUS4 - Trans
Fetal bowel anomalies 1245heterozygoteCF-causing - Trans
Fetal bowel anomalies 1436heterozygoteCF-causing - Trans
Pancreatitis 1662heterozygotevarying clinical consequence- Undef
Bronchiectasis 2022heterozygotevarying clinical consequence - Trans
Bronchiectasis 4550heterozygotevarying clinical consequence- Undef
Bronchiectasis 1868heterozygotevarying clinical consequence - Trans
Asymptomatic compound heterozygote 1879heterozygoteVUS3- Undef


Color code:   non disease-causing <   VUS1 <   VUS2 <   VUS3 <   VUS4 <   VUS5 <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare