Variant NM_000492.4:c.3870A>G


Variant details:
Name NM_000492.4:c.3870A>G
Protein name NP_000483.3:p.(=)
Genomic name (hg19) chr7:g.117282644A>G    UCSC    gnomAD
#Exon/intron exon 23
Legacy Name P1290P (4002A/G)
Class non disease-causing
WT sequence GGAGGAAAGCCTTTGGAGTGATACC A CAGGTGAGCAAAAGGACTTAGCCAG
Mutant sequence GGAGGAAAGCCTTTGGAGTGATACC G CAGGTGAGCAAAAGGACTTAGCCAG






External sources:

Not found		dbSNP
rs1800130
Not found







5 individuals carrying this variant are reported in CFTR-NGS catalogue


48 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 48
Asymptomatic compound heterozygote 2
CF 14
CFTR-RD31
  • Bronchiectasis  3
  • CBAVD  17
  • Other  6
  • Pancreatitis  5
Pending (NBS) 1



Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 4744heterozygoteCF-causing- Undef
VUS3- Undef
CF 3200heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5770heterozygoteVUS3- Undef
CF-causing- Undef
CF 4480heterozygoteCF-causing- Undef
VUS2- Undef
CF 3439heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3007heterozygoteCF-causing - Cis
CF-causing - Trans
CF 686heterozygoteVUS3- Undef
CF 303heterozygoteCF-causing- Undef
CF-causing- Undef
CF 252heterozygoteCF-causing- Undef
CF-causing- Undef
CF 177heterozygoteCF-causing- Undef
CF-causing- Undef
CF 176heterozygoteCF-causing- Undef
CF-causing- Undef
CF 47heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 1528heterozygote
CF 1178heterozygoteCF-causing- Undef
CF-causing- Undef
CBAVD 4586heterozygoteCFTR-RD-causing- Undef
CBAVD 5343heterozygoteVUS3- Undef
VUS3- Undef
CBAVD 5946heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 4814heterozygoteVUS2- Undef
CF-causing- Undef
CBAVD 4248heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS4- Undef
CBAVD 4247heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS4- Undef
CBAVD 2504heterozygotevarying clinical consequence- Undef
CF-causing- Undef
VUS1- Undef
CBAVD 448heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 424heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 4729heterozygoteVUS3- Undef
VUS5- Undef
CBAVD 720heterozygoteCFTR-RD-causing- Undef
CBAVD 806heterozygoteVUS3- Undef
CBAVD 2292heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 1294heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 1276heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
CBAVD 1025heterozygoteVUS4- Undef
CBAVD 868heterozygoteCF-causing- Undef
VUS4- Undef
Pancreatitis 5617heterozygoteVUS3- Undef
Pancreatitis 5611heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 5974heterozygoteVUS3- Undef
Pancreatitis 5010heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 669heterozygoteCF-causing- Undef
Bronchiectasis 4253heterozygoteVUS4- Undef
Bronchiectasis 2501heterozygoteVUS2- Undef
VUS3- Undef
Bronchiectasis 1068heterozygoteCF-causing- Undef
VUS5- Undef
Other 5175heterozygoteCF-causing- Undef
VUS3- Undef
Other 5775heterozygoteCF-causing- Undef
VUS3- Undef
VUS3- Undef
Other 4539heterozygoteVUS2- Undef
VUS3- Undef
VUS1- Undef
Other 5187heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 1069heterozygoteCF-causing- Undef
VUS5- Undef
Other 4587homozygotec.2421A>G - p.(Ile807Met) - Trans
Pending (NBS) 5609heterozygoteVUS3- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 4526heterozygoteVUS1- Undef
VUS1- Undef
Asymptomatic compound heterozygote 4303heterozygoteVUS2- Undef
CFTR-RD-causing- Undef


Color code:   non disease-causing <   VUS1 <   VUS2 <   VUS3 <   VUS4 <   VUS5 <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare