Variant NM_000492.4:c.3874-200G>A


Variant details:
Name NM_000492.4:c.3874-200G>A
Protein name NP_000483.3:p.(=)
Genomic name (hg19) chr7:g.117292696G>A    UCSC    gnomAD
#Exon/intron intron 23
Legacy Name 4006-200G/A
Class non disease-causing
WT sequence TTCACAAGGGACTCCAAATATTGCT G TAGTATTTGTTTCTTAAAAGAATGA
Mutant sequence TTCACAAGGGACTCCAAATATTGCT A TAGTATTTGTTTCTTAAAAGAATGA






External sources:

Not found		dbSNP
rs214164
Not found







48 individuals carrying this variant are reported in CFTR-NGS catalogue


98 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 98
Asymptomatic compound heterozygote 2
CF 17
CFTR-RD71
  • Bronchiectasis  15
  • CBAVD  20
  • CRS-NP  1
  • Other  7
  • Pancreatitis  28
Pending 2
Pending (NBS) 6



Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
Pending 243heterozygoteCFTR-RD-causing- Undef
Pending 1097heterozygotevarying clinical consequence - Cis
VUS4 - Trans
CF 2361heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2442heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2459heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4535heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4538heterozygoteVUS3- Undef
CF-causing- Undef
CF-causing- Undef
CF 2489heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 2495heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CF-causing- Undef
CF 2568heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4785heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 4782heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 281heterozygoteCF-causing- Undef
CF-causing- Undef
CF 654heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1128heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
varying clinical consequence- Undef
CF-causing- Undef
CF 2333heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1138heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1139heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1170heterozygoteCF-causing- Undef
CF-causing- Undef
CBAVD 2421heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 2411heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 2485heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS1- Undef
CBAVD 3125heterozygoteCF-causing- Undef
VUS1- Undef
varying clinical consequence- Undef
CBAVD 4534heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4536heterozygoteCF-causing- Undef
CBAVD 5018heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 2525heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4612heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 1052heterozygotevarying clinical consequence- Undef
varying clinical consequence- Undef
CBAVD 1056heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 423heterozygoteVUS3- Undef
CBAVD 658heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 659heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
CBAVD 664heterozygote
CBAVD 676heterozygoteVUS3- Undef
CBAVD 682heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 690heterozygote
CBAVD 1163heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 1132homozygotec.3208C>T - p.(Arg1070Trp) - Trans
c.509G>A - p.(Arg170His) - Trans
Pending (NBS) 4407heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 4606heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending (NBS) 2520heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 1076heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 4769heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 1180heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 2433heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
Other 2434heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 2544heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 1089heterozygotevarying clinical consequence - Cis
Other 1099heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4783heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 1124heterozygotevarying clinical consequence- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 2427heterozygoteVUS3- Undef
Pancreatitis 2451heterozygoteVUS3- Undef
Pancreatitis 2471heterozygoteVUS4- Undef
VUS4- Undef
Pancreatitis 2473heterozygoteVUS3- Undef
CF-causing- Undef
Pancreatitis 2422heterozygote
Pancreatitis 2364heterozygote
Pancreatitis 2377heterozygoteCF-causing- Undef
Pancreatitis 2408heterozygote
Pancreatitis 2414heterozygote
Pancreatitis 2418heterozygoteVUS3- Undef
Pancreatitis 2483heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2486heterozygoteVUS3- Undef
VUS1- Undef
CFTR-RD-causing- Undef
Pancreatitis 2488heterozygoteVUS3- Undef
Pancreatitis 2528heterozygoteVUS4- Undef
Pancreatitis 2553heterozygoteCF-causing- Undef
Pancreatitis 1063heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pancreatitis 2306heterozygoteVUS3- Undef
Pancreatitis 2312heterozygoteVUS3- Undef
Pancreatitis 2318heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 2319heterozygote
Pancreatitis 2321heterozygote
Pancreatitis 2322heterozygote
Pancreatitis 2324heterozygoteVUS3- Undef
Pancreatitis 2329heterozygoteVUS1- Undef
Pancreatitis 2338heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 2305heterozygoteVUS3- Undef
Pancreatitis 1161heterozygoteCF-causing- Undef
VUS1- Undef
Pancreatitis 2285heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2424heterozygote
Bronchiectasis 2446heterozygoteVUS3- Undef
CF-causing- Undef
Bronchiectasis 2367heterozygoteCFTR-RD-causing- Undef
Bronchiectasis 2409heterozygoteCF-causing- Undef
VUS3- Undef
Bronchiectasis 2419heterozygoteVUS3- Undef
VUS1- Undef
Bronchiectasis 2420heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 4602heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 2501heterozygoteVUS2- Undef
VUS3- Undef
Bronchiectasis 1096heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 1120heterozygotevarying clinical consequence- Undef
Bronchiectasis 2342heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Bronchiectasis 2298heterozygoteVUS3- Undef
Bronchiectasis 2287heterozygoteVUS3- Undef
CF-causing- Undef
Bronchiectasis 2289heterozygoteVUS3- Undef
Bronchiectasis 2291heterozygoteVUS3- Undef
Asymptomatic compound heterozygote 4260heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 2966heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS1- Undef
CF-causing- Undef
CRS-NP 3161heterozygoteCF-causing- Undef
VUS1- Undef
varying clinical consequence- Undef


Color code:   non disease-causing <   VUS1 <   VUS2 <   VUS3 <   VUS4 <   VUS5 <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare