Variant NM_000492.4:c.1393-61A>G


Variant details:
Name NM_000492.4:c.1393-61A>G
Protein name NP_000483.3:p.(=)
Genomic name (hg19) chr7:g.117199457A>G    UCSC    gnomAD
#Exon/intron intron 10
Legacy Name 1525-61A/G
Class non disease-causing
WT sequence CACTTCTGCTTAGGATGATAATTGG A GGCAAGTGAATCCTGAGCGTGATTT
Mutant sequence CACTTCTGCTTAGGATGATAATTGG G GGCAAGTGAATCCTGAGCGTGATTT






External sources:

Not found		dbSNP
rs34855237
Not found







73 individuals carrying this variant are reported in CFTR-NGS catalogue


248 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 248
Asymptomatic compound heterozygote 12
CF 78
CFTR-RD124
  • Aquagenic palmoplantar keratoderma  1
  • Bronchiectasis  11
  • CBAVD  70
  • CRS-NP  3
  • Other  32
  • Pancreatitis  7
Fetal bowel anomalies 5
Pending 3
Pending (NBS) 22
Pending non-CF 4



Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 953heterozygoteCF-causing- Undef
CF-causing- Undef
CF 920heterozygoteVUS2- Undef
CF-causing- Undef
CF-causing- Undef
CF 913heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 909heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 924heterozygoteCF-causing- Undef
CF-causing- Undef
CF 952heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 947heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 945heterozygoteCF-causing- Undef
CF-causing- Undef
CF 926heterozygoteCF-causing - Cis
varying clinical consequence - Trans
CF 835heterozygoteCF-causing- Undef
CF-causing- Undef
CF 829heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CF 808heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 787heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 884heterozygoteCF-causing - Cis
CF-causing - Trans
CF 882heterozygoteVUS4- Undef
CF-causing- Undef
CF 956heterozygoteCF-causing - Cis
CF-causing - Trans
CF 5185heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 4796heterozygoteCF-causing - Cis
CF-causing - Trans
VUS3- Undef
VUS3- Undef
varying clinical consequence- Undef
CF 4791heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 5186heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CF 5066heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5064heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2880heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 5189heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CF 5143heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4832heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4831heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
varying clinical consequence- Undef
CF 989heterozygoteCF-causing- Undef
CF-causing- Undef
CF 984heterozygoteCF-causing- Undef
CF-causing- Undef
CF 975heterozygoteCF-causing- Undef
VUS4- Undef
CF 5256heterozygoteVUS3- Undef
VUS2- Undef
CF-causing- Undef
CF 651heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4732heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 4845heterozygoteCF-causing- Undef
CF-causing- Undef
CF 96heterozygoteVUS2 - Cis
CF-causing - Cis
CF-causing - Trans
CF 586heterozygoteCF-causing- Undef
CF-causing- Undef
CF 561heterozygoteCF-causing- Undef
CF-causing- Undef
CF 316heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 313heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
varying clinical consequence- Undef
CF 206heterozygoteCF-causing- Undef
CF 152heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4719heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4716heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4665heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CF 652heterozygoteCF-causing- Undef
CF-causing- Undef
CF 733heterozygoteCF-causing- Undef
VUS3- Undef
CF 711heterozygoteCF-causing- Undef
CF-causing- Undef
CF 703heterozygoteCF-causing- Undef
CF-causing- Undef
CF 696heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CF-causing- Undef
CF 691heterozygoteCF-causing- Undef
CF-causing- Undef
CF 738heterozygoteCF-causing- Undef
CF-causing- Undef
CF 762heterozygoteCF-causing- Undef
CF-causing- Undef
CF 761heterozygoteCF-causing- Undef
CF-causing- Undef
CF 745heterozygoteCF-causing- Undef
CF-causing- Undef
CF 744heterozygoteVUS3- Undef
CF 688heterozygoteCF-causing- Undef
CF-causing- Undef
CF 672heterozygoteCF-causing- Undef
CF-causing- Undef
CF 662heterozygoteVUS2- Undef
CF-causing- Undef
varying clinical consequence- Undef
CF 666heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 663heterozygoteVUS2- Undef
CF-causing- Undef
varying clinical consequence- Undef
CF 654heterozygoteCF-causing- Undef
CF-causing- Undef
CF 668heterozygoteCF-causing- Undef
CF-causing- Undef
CF 686heterozygoteVUS3- Undef
CF 681heterozygoteCF-causing- Undef
CF-causing- Undef
CF 637homozygotec.3484C>T - p.(Arg1162*) - Trans
c.695T>A - p.(Val232Asp) - Trans
CF 973homozygotec.1521_1523del - p.(Phe508del) - Trans
c.1624G>T - p.(Gly542*) - Trans
CF 3969homozygotec.1521_1523del - p.(Phe508del) - Trans
c.2988+1173_3468+2111del - p.(Leu997_Leu1156del) - Trans
CF 943homozygotec.1040G>A - p.(Arg347His) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CF 3963homozygotec.1521_1523del - p.(Phe508del) - Trans
CF 1140homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3964-78_4242+577del - p.(Gly1323_Val1415del) - Trans
CF 905homozygotec.1521_1523del - p.(Phe508del) - Trans
CF 5534homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3605del - p.(Asp1202Alafs*9) - Trans
CF 716homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3705T>G - p.(Ser1235Arg) - Trans
c.3822G>A - p.(Trp1274*) - Trans
CF 863homozygotec.1521_1523del - p.(Phe508del) - Trans
c.1705T>G - p.(Tyr569Asp) - Trans
CF 946homozygotec.1521_1523del - p.(Phe508del) - Trans
CF 930homozygotec.3909C>G - p.(Asn1303Lys) - Trans
CF 982homozygotec.1521_1523del - p.(Phe508del) - Trans
CF 343homozygotec.1585-9412A>G - p.(=) - Trans
c.3909C>G - p.(Asn1303Lys) - Trans
Fetal bowel anomalies 4670heterozygoteCF-causing - Cis
CF-causing - Trans
Fetal bowel anomalies 4709heterozygoteCF-causing - Cis
CF-causing - Trans
Fetal bowel anomalies 917heterozygoteCF-causing- Undef
CF-causing- Undef
Fetal bowel anomalies 923heterozygoteCF-causing - Cis
CF-causing - Trans
Fetal bowel anomalies 948heterozygoteCF-causing - Cis
CF-causing - Trans
Other 937heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 845heterozygoteCF-causing- Undef
Other 779heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 877heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 864heterozygoteCF-causing- Undef
VUS3- Undef
Other 3247heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 5184heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
Other 4800heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
Other 4799heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Other 5128heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 5823heterozygoteVUS3- Undef
CF-causing- Undef
VUS1- Undef
VUS1- Undef
Other 5201heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 980heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
varying clinical consequence- Undef
Other 5243heterozygoteVUS3- Undef
VUS3- Undef
VUS1- Undef
Other 5264heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CF-causing- Undef
Other 5518heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4844heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 4836heterozygoteCF-causing- Undef
VUS3- Undef
Other 4846heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 4695heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4690heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4686heterozygoteVUS3- Undef
CF-causing- Undef
Other 4671heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Other 4702heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Other 4705heterozygoteCF-causing- Undef
CF-causing- Undef
Other 4715heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4714heterozygoteCF-causing- Undef
Other 4713heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
Other 757heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 756heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 940homozygotec.1521_1523del - p.(Phe508del) - Trans
Other 4698homozygotec.1521_1523del - p.(Phe508del) - Trans
c.2619+106T>A - p.(=) - Trans
c.2909-15T>G - p.(=) - Trans
Asymptomatic compound heterozygote 925heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 932heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
VUS4 - Trans
Asymptomatic compound heterozygote 4829heterozygoteCF-causing- Undef
VUS2- Undef
Asymptomatic compound heterozygote 5818heterozygoteVUS2- Undef
VUS3- Undef
Asymptomatic compound heterozygote 4961heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 4840heterozygoteVUS1- Undef
Asymptomatic compound heterozygote 4839heterozygoteCF-causing- Undef
VUS2- Undef
Asymptomatic compound heterozygote 372heterozygoteVUS1 - Cis
CF-causing - Trans
Asymptomatic compound heterozygote 5077heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5081heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS1- Undef
Asymptomatic compound heterozygote 4685heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5140homozygotec.1118A>G - p.(Asp373Gly) - Trans
c.1521_1523del - p.(Phe508del) - Trans
Bronchiectasis 921heterozygoteCF-causing- Undef
VUS3- Undef
Bronchiectasis 950heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 899heterozygoteCF-causing- Undef
Bronchiectasis 850heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 5182heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Bronchiectasis 5200heterozygoteCF-causing- Undef
VUS5- Undef
VUS3- Undef
Bronchiectasis 4833heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 4734heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4725heterozygoteCF-causing- Undef
VUS5- Undef
Bronchiectasis 4678heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 5826homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3718-2477C>T - p.(=) - Trans
CBAVD 918heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 912heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 904heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
CBAVD 900heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 949heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 927heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
VUS4 - Trans
CBAVD 897heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 895heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 849heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 840heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 834heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 806heterozygoteVUS3- Undef
CBAVD 859heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 894heterozygotevarying clinical consequence- Undef
VUS3- Undef
CBAVD 893heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 891heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
CBAVD 890heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
CBAVD 876heterozygoteCF-causing- Undef
VUS4- Undef
CBAVD 875heterozygoteCF-causing- Undef
VUS4- Undef
CBAVD 873heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 868heterozygoteCF-causing- Undef
VUS4- Undef
CBAVD 5821heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 5181heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
CBAVD 1469heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 5234heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 4830heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 988heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 978heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 5809heterozygoteVUS4- Undef
VUS3- Undef
CBAVD 4740heterozygoteCF-causing- Undef
VUS1- Undef
CBAVD 413heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4722heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4956heterozygotevarying clinical consequence- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 626heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 515heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4699heterozygoteCFTR-RD-causing- Undef
VUS2- Undef
CF-causing- Undef
CBAVD 4683heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4682heterozygoteCF-causing- Undef
VUS1- Undef
CFTR-RD-causing- Undef
CBAVD 4679heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4703heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4717heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4707heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 4706heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 735heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 728heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 724heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 721heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 717heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 712heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 710heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 736heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 774heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 765heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 763heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 751heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 746heterozygoteCFTR-RD-causing- Undef
CBAVD 743heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 678heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 665heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 653heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
varying clinical consequence- Undef
CBAVD 658heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 675heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 656heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 687heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 682heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 679heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 647homozygotec.1040G>A - p.(Arg347His) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CBAVD 786homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.1521_1523del - p.(Phe508del) - Trans
CBAVD 837homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.1521_1523del - p.(Phe508del) - Trans
CBAVD 838homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3415A>G - p.(Ile1139Val) - Trans
Pending (NBS) 951heterozygoteVUS2- Undef
CF-causing- Undef
VUS4- Undef
Pending (NBS) 944heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
Pending (NBS) 799heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 794heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5183heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
Pending (NBS) 4787heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Pending (NBS) 5817heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending (NBS) 5202heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
Pending (NBS) 5190heterozygoteCF-causing- Undef
VUS3- Undef
VUS3- Undef
varying clinical consequence- Undef
Pending (NBS) 5808heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 5816heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 5820heterozygoteCF-causing- Undef
VUS3- Undef
CFTR-RD-causing- Undef
Pending (NBS) 5533heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 5247heterozygoteVUS3- Undef
VUS3- Undef
CF-causing- Undef
VUS1- Undef
Pending (NBS) 5089heterozygoteCF-causing - Cis
varying clinical consequence - Trans
Pending (NBS) 4720heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending (NBS) 4694heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 775heterozygoteCF-causing- Undef
Pending (NBS) 734heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 646homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.1521_1523del - p.(Phe508del) - Trans
Pending (NBS) 726homozygotec.1521_1523del - p.(Phe508del) - Trans
c.1801A>T - p.(Ile601Phe) - Trans
Pending (NBS) 5244homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3705T>G - p.(Ser1235Arg) - Trans
c.941G>T - p.(Gly314Val) - Trans
Pending 4680heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending 907heterozygoteCF-causing- Undef
VUS3- Undef
Pending 5216heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending non-CF 4681heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending non-CF 4704heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending non-CF 4677heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending non-CF 753heterozygoteCF-causing- Undef
VUS3- Undef
Pancreatitis 776heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pancreatitis 3245heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
Pancreatitis 5142heterozygoteVUS3- Undef
CF-causing- Undef
Pancreatitis 5145heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 964heterozygoteCFTR-RD-causing- Undef
VUS4- Undef
Pancreatitis 4721heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pancreatitis 669heterozygoteCF-causing- Undef
CRS-NP 349heterozygoteCF-causing- Undef
VUS1- Undef
VUS1- Undef
CRS-NP 910heterozygoteCF-causing- Undef
CRS-NP 5531heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
Aquagenic palmoplantar keratoderma 4827heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef


Color code:   non disease-causing <   VUS1 <   VUS2 <   VUS3 <   VUS4 <   VUS5 <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare