Variant NM_000492.4:c.869+11C>T


Variant details:
Name NM_000492.4:c.869+11C>T
Protein name NP_000483.3:p.(=)
Genomic name (hg19) chr7:g.117176738C>T    UCSC    gnomAD
#Exon/intron intron 7
Legacy Name 1001+11C/T
Class non disease-causing
WT sequence TGAAAACTTAAGACAGTAAGTTGTT C CAATAATTTCAATATTGTTAGTAAT
Mutant sequence TGAAAACTTAAGACAGTAAGTTGTT T CAATAATTTCAATATTGTTAGTAAT






External sources:

Not found		dbSNP
rs1800503
Not found







59 individuals carrying this variant are reported in CFTR-NGS catalogue


692 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 692
Asymptomatic compound heterozygote 11
CF 265
CFTR-RD358
  • Aquagenic palmoplantar keratoderma  2
  • Bronchiectasis  47
  • CBAVD  201
  • CRS-NP  10
  • Other  66
  • Pancreatitis  32
Fetal bowel anomalies 2
Pending 5
Pending (NBS) 49
Pending non-CF 2



Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CBAVD 3063heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 2565heterozygoteCF-causing- Undef
CBAVD 2556heterozygoteCF-causing- Undef
VUS4- Undef
CBAVD 2853heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
CFTR-RD-causing - Trans
CFTR-RD-causing - Trans
CBAVD 5018heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 2549heterozygoteCF-causing- Undef
CBAVD 2512heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 2485heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS1- Undef
CBAVD 2514heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 2531heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 2525heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5068heterozygoteCF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CBAVD 3064heterozygoteVUS3 - Cis
CF-causing - Trans
CBAVD 3062heterozygoteCF-causing - Cis
varying clinical consequence - Trans
CBAVD 4651heterozygoteVUS3- Undef
CF-causing- Undef
VUS1- Undef
CBAVD 4650heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4624heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4622heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 4663heterozygotevarying clinical consequence- Undef
VUS3- Undef
CF-causing- Undef
CBAVD 4756heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5015heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4755heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 4754heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4753heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4752heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4761heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 1284heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 1272heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 1301heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 1314heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 2421heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 2398heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 2390heterozygoteCF-causing- Undef
CBAVD 2460heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CF-causing- Undef
CBAVD 2292heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 5594heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4311heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4310heterozygoteCF-causing- Undef
CBAVD 4291heterozygoteVUS4- Undef
CBAVD 4279heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5947heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5946heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 5943heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4578heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4574heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4571heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4566heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4586heterozygoteCFTR-RD-causing- Undef
CBAVD 4612heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4598heterozygoteCF-causing- Undef
VUS1- Undef
VUS2- Undef
CBAVD 4562heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4814heterozygoteVUS2- Undef
CF-causing- Undef
CBAVD 4419heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4543heterozygotevarying clinical consequence- Undef
VUS4- Undef
CBAVD 4531heterozygoteCF-causing- Undef
VUS1- Undef
CBAVD 3288heterozygoteCF-causing- Undef
VUS1- Undef
VUS3- Undef
CBAVD 3267heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 3125heterozygoteCF-causing- Undef
VUS1- Undef
varying clinical consequence- Undef
CBAVD 3201heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 3208heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 3388heterozygoteCF-causing - Cis
VUS3 - Trans
CBAVD 5765heterozygotevarying clinical consequence- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 5764heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5600heterozygoteVUS3- Undef
CBAVD 5610heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5603heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5343heterozygoteVUS3- Undef
VUS3- Undef
CBAVD 5173heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS1- Undef
CBAVD 5346heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5969heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 5968heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5944heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5591heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 5590heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 525heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 495heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS1- Undef
CBAVD 494heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 493heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 492heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 491heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 490heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 484heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 480heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 497heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 498heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 522heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 520heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 514heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 512heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 505heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 501heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 500heterozygoteVUS4- Undef
CF-causing- Undef
CBAVD 499heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS1- Undef
CBAVD 477heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 476heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 475heterozygoteVUS3- Undef
VUS1- Undef
CF-causing- Undef
CBAVD 451heterozygoteCF-causing- Undef
VUS1- Undef
VUS5- Undef
CBAVD 450heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 447heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 446heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 444heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 438heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 436heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 397heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 452heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 454heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 468heterozygoteCF-causing- Undef
CBAVD 467heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 463heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 462heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 458heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 456heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 528heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 619heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS1- Undef
CBAVD 614heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 599heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 632heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 665heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 658heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 591heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 589heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 553heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 552heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 549heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 548heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 544heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 541heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 535heterozygoteCF-causing- Undef
VUS1- Undef
varying clinical consequence- Undef
CBAVD 534heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 555heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 556heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 572heterozygoteCF-causing- Undef
VUS4- Undef
CBAVD 532heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS1- Undef
CBAVD 4683heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4682heterozygoteCF-causing- Undef
VUS1- Undef
CFTR-RD-causing- Undef
CBAVD 4679heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 4699heterozygoteCFTR-RD-causing- Undef
VUS2- Undef
CF-causing- Undef
CBAVD 4740heterozygoteCF-causing- Undef
VUS1- Undef
CBAVD 413heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4706heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 65heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 5072heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 1056heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 1055heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 1048heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 927heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS4- Undef
CBAVD 949heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 5229heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5809heterozygoteVUS4- Undef
VUS3- Undef
CBAVD 5223heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 978heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 918heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 1163heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 1244heterozygoteCF-causing- Undef
VUS5- Undef
CBAVD 1067heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 1066heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 1065heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 5181heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
CBAVD 5234heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 786heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 751heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 743heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 736heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 735heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 774heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 765heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 763heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 728heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 687heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 682heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 679heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 678heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 675heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 724heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 721heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 717heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 712heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 710heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 876heterozygoteCF-causing- Undef
VUS4- Undef
CBAVD 875heterozygoteCF-causing- Undef
VUS4- Undef
CBAVD 873heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 868heterozygoteCF-causing- Undef
VUS4- Undef
CBAVD 859heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 857heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 891heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 900heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 897heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 895heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 912heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 893heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 856heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 849heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 840heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 834heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 837heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 841heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 792heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 810heterozygoteVUS2- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 647homozygotec.1040G>A - p.(Arg347His) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CBAVD 838homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3415A>G - p.(Ile1139Val) - Trans
CBAVD 5344homozygotec.1364C>A - p.(Ala455Glu) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CF 2882heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 2763heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2761heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2760heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 2568heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2797heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2880heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 2842heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5067heterozygoteCF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CF 2828heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2821heterozygotevarying clinical consequence - Cis
CF-causing - Trans
CF 2802heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2499heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2495heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CF-causing- Undef
CF 2494heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2489heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 2515heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2524heterozygoteVUS3- Undef
CF-causing- Undef
CF 2479heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2883heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5064heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3026heterozygoteCF-causing - Cis
VUS3 - Trans
CF-causing - Trans
CF 3021heterozygoteCF-causing - Cis
varying clinical consequence - Trans
CF 3000heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2973heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2962heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 2955heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4633heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4759heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3070heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2898heterozygoteVUS1- Undef
CF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 2897heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2893heterozygoteCF-causing- Undef
CF-causing- Undef
VUS1- Undef
CF 2889heterozygoteCF-causing- Undef
VUS1- Undef
VUS4- Undef
CF 2888heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1558heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1516heterozygoteCF-causing- Undef
VUS2- Undef
CF 4859heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4854heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4855heterozygoteVUS3- Undef
CF-causing- Undef
CF 4858heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4864heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4862heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1527heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF 1528heterozygote
CF 1550heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1549heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF-causing- Undef
CF 1546heterozygoteCF-causing- Undef
CF 1539heterozygoteCF-causing- Undef
CF 1297heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1278heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1273heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1266heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1300heterozygoteCF-causing- Undef
CF 1309heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4853heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1317heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 1315heterozygoteCF-causing - Cis
CF-causing - Trans
CF 1311heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1310heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1258heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1560heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2429heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2472heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2459heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2385heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2380heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2283heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1757heterozygoteCF-causing- Undef
VUS3- Undef
CF 1585heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1577heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1571heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF 2363heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2361heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2350heterozygoteCF-causing- Undef
CF 2343heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CF 2333heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1562heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CF 4043heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3917heterozygoteCF-causing - Cis
varying clinical consequence - Trans
CF 3674heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5335heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4307heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4290heterozygoteCF-causing - Cis
CF-causing - Trans
CF 4287heterozygoteCF-causing- Undef
CF 5574heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
CF 5767heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5965heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5963heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5622heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4580heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4585heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4605heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4603heterozygoteCF-causing - Cis
CF-causing - Trans
CF 4596heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4807heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4804heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4323heterozygoteCF-causing - Cis
CF-causing - Trans
CF 4439heterozygoteVUS5- Undef
CF-causing- Undef
CF 4502heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 4560heterozygoteCF-causing- Undef
VUS4- Undef
CF 4535heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3282heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3275heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 4747heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4744heterozygoteCF-causing- Undef
VUS3- Undef
CF 4764heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4629heterozygoteCF-causing- Undef
CF-causing- Undef
VUS1- Undef
CF 3200heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3180heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3142heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 3140heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 3119heterozygoteCF-causing- Undef
CF-causing- Undef
VUS1- Undef
CF 5016heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 3212heterozygoteCF-causing- Undef
VUS4- Undef
CF 3243heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5066heterozygoteCF-causing- Undef
CF-causing- Undef
CF 3217heterozygoteCF-causing - Cis
CF-causing - Trans
CF 3215heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5168heterozygoteCF-causing- Undef
VUS3- Undef
CF-causing- Undef
VUS3- Undef
CF 5174heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5006heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5345heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5971heterozygoteCF-causing- Undef
VUS3- Undef
CF 471heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 666heterozygoteCF-causing - Cis
CF-causing - Trans
VUS3 - Trans
CF 601heterozygoteCF-causing- Undef
CF-causing- Undef
CF 600heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 597heterozygoteCF-causing- Undef
CF-causing- Undef
CF 596heterozygoteCF-causing- Undef
CF-causing- Undef
CF 594heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 620heterozygoteCF-causing- Undef
CF-causing- Undef
CF 663heterozygoteVUS2- Undef
CF-causing- Undef
varying clinical consequence- Undef
CF 662heterozygoteVUS2- Undef
CF-causing- Undef
varying clinical consequence- Undef
CF 654heterozygoteCF-causing- Undef
CF-causing- Undef
CF 651heterozygoteCF-causing- Undef
CF-causing- Undef
CF 637heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 586heterozygoteCF-causing- Undef
CF-causing- Undef
CF 582heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 576heterozygoteCF-causing- Undef
CF-causing- Undef
CF 567heterozygoteCF-causing- Undef
CF-causing- Undef
CF 561heterozygoteCF-causing- Undef
CF-causing- Undef
CF 559heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 384heterozygoteCF-causing- Undef
CF-causing- Undef
CF 184heterozygoteCF-causing- Undef
CF-causing- Undef
CF 161heterozygoteCF-causing- Undef
CF-causing- Undef
CF 160heterozygoteCF-causing- Undef
CF-causing- Undef
CF 159heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 158heterozygoteCF-causing- Undef
CF-causing- Undef
CF 152heterozygoteCF-causing- Undef
CF-causing- Undef
CF 145heterozygoteCF-causing- Undef
CF-causing- Undef
CF 143heterozygoteCF-causing- Undef
CF-causing- Undef
CF 139heterozygoteCF-causing- Undef
VUS4- Undef
CF 166heterozygoteCF-causing- Undef
CF-causing- Undef
CF 167heterozygoteCF-causing- Undef
CF-causing- Undef
CF 181heterozygoteCF-causing- Undef
CF-causing- Undef
CF 178heterozygoteCF-causing- Undef
CF-causing- Undef
VUS1- Undef
VUS1- Undef
CF 177heterozygoteCF-causing- Undef
CF-causing- Undef
CF 175heterozygoteCF-causing- Undef
CF-causing- Undef
CF 174heterozygoteCF-causing- Undef
CF-causing- Undef
CF 173heterozygoteCF-causing- Undef
CF-causing- Undef
CF 169heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 168heterozygoteCF-causing- Undef
CF 4665heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CF 4732heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 4719heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 383heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF-causing- Undef
CF 351heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 350heterozygoteCF-causing- Undef
CF-causing- Undef
CF 341heterozygoteCF-causing- Undef
CF-causing- Undef
CF 340heterozygoteVUS1- Undef
CF-causing- Undef
CF-causing- Undef
CF 338heterozygoteCF-causing- Undef
VUS5- Undef
CF 335heterozygoteCF-causing- Undef
CF-causing- Undef
CF 326heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 313heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
varying clinical consequence- Undef
CF 382heterozygoteCF-causing- Undef
VUS3- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CF 380heterozygoteCF-causing- Undef
CF-causing- Undef
CF 374heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF 373heterozygoteCF-causing- Undef
CF-causing- Undef
CF 369heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 363heterozygoteCF-causing- Undef
CF-causing- Undef
CF 361heterozygoteCF-causing- Undef
CF-causing- Undef
CF 359heterozygoteCF-causing- Undef
CF-causing- Undef
VUS1- Undef
CF 304heterozygoteCF-causing- Undef
CF-causing- Undef
VUS1- Undef
CF 283heterozygoteCF-causing- Undef
CF-causing- Undef
CF 280heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 222heterozygoteCF-causing- Undef
CF-causing- Undef
CF 221heterozygoteCF-causing- Undef
CF-causing- Undef
CF 218heterozygoteCF-causing- Undef
CF-causing- Undef
CF 212heterozygoteCF-causing- Undef
CF-causing- Undef
CF 207heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 206heterozygoteCF-causing- Undef
CF 195heterozygoteCF-causing- Undef
VUS1- Undef
CF-causing- Undef
CF 225heterozygoteCF-causing- Undef
VUS4- Undef
CF 227heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 276heterozygoteCF-causing- Undef
CF-causing- Undef
CF 265heterozygoteCF-causing- Undef
CF-causing- Undef
CF 251heterozygoteCF-causing- Undef
CF-causing- Undef
CF 249heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 236heterozygoteCF-causing- Undef
CF-causing- Undef
CF 234heterozygoteCF-causing- Undef
CF-causing- Undef
CF 232heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 193heterozygoteCF-causing- Undef
CF-causing- Undef
CF 668heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4782heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1018heterozygoteCF-causing- Undef
VUS3- Undef
CF 4785heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 1042heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CF-causing- Undef
CF 4796heterozygoteCF-causing - Cis
CF-causing - Trans
VUS3- Undef
VUS3- Undef
varying clinical consequence- Undef
CF 4791heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 5256heterozygoteVUS3- Undef
VUS2- Undef
CF-causing- Undef
CF 947heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 945heterozygoteCF-causing- Undef
CF-causing- Undef
CF 943heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 924heterozygoteCF-causing- Undef
CF-causing- Undef
CF 920heterozygoteVUS2- Undef
CF-causing- Undef
CF-causing- Undef
CF 975heterozygoteCF-causing- Undef
VUS4- Undef
CF 1151heterozygoteCF-causing- Undef
VUS4- Undef
CF 1139heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1137heterozygoteCF-causing - Cis
CF-causing - Trans
VUS1 - Trans
CF 1125heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1121heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1157heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1232heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 1228heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1178heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1166heterozygoteCF-causing- Undef
CF-causing- Undef
CF 1101heterozygoteCF-causing- Undef
VUS3- Undef
CF-causing- Undef
CF 5186heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CF 5185heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 5189heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CF 913heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 745heterozygoteCF-causing- Undef
CF-causing- Undef
CF 744heterozygoteVUS3- Undef
CF 762heterozygoteCF-causing- Undef
CF-causing- Undef
CF 761heterozygoteCF-causing- Undef
CF-causing- Undef
CF 733heterozygoteCF-causing- Undef
VUS3- Undef
CF 688heterozygoteCF-causing - Cis
CF-causing - Trans
CF 681heterozygoteCF-causing- Undef
CF-causing- Undef
CF 672heterozygoteCF-causing- Undef
CF-causing- Undef
CF 691heterozygoteCF-causing- Undef
CF-causing- Undef
CF 696heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CF-causing- Undef
CF 716heterozygoteCF-causing- Undef
VUS1- Undef
CF-causing- Undef
CF 711heterozygoteCF-causing- Undef
CF-causing- Undef
CF 703heterozygoteCF-causing- Undef
CF-causing- Undef
CF 787heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 882heterozygoteVUS4- Undef
CF-causing- Undef
CF 863heterozygoteCF-causing- Undef
CF-causing- Undef
CF 884heterozygoteCF-causing- Undef
CF-causing- Undef
CF 909heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 738heterozygoteCF-causing- Undef
CF-causing- Undef
CF 808heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 835heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4594homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3080T>C - p.(Ile1027Thr) - Trans
c.3196C>T - p.(Arg1066Cys) - Trans
CF 3071homozygotec.1364C>A - p.(Ala455Glu) - Trans
c.1624G>T - p.(Gly542*) - Trans
CF 3192homozygotec.1364C>A - p.(Ala455Glu) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CF 1140homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3964-78_4242+577del - p.(Gly1323_Val1415del) - Trans
CF 333homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3718-2477C>T - p.(=) - Trans
CF 568homozygotec.1521_1523del - p.(Phe508del) - Trans
c.2770G>A - p.(Asp924Asn) - Trans
CF 343homozygotec.1585-9412A>G - p.(=) - Trans
c.3909C>G - p.(Asn1303Lys) - Trans
CF 3969homozygotec.1521_1523del - p.(Phe508del) - Trans
c.2988+1173_3468+2111del - p.(Leu997_Leu1156del) - Trans
CF 318homozygotec.1364C>A - p.(Ala455Glu) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CF 3229homozygotec.1364C>A - p.(Ala455Glu) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CF 595homozygotec.1521_1523del - p.(Phe508del) - Trans
CF 611homozygotec.1521_1523del - p.(Phe508del) - Trans
c.2538G>A - p.(Trp846*) - Trans
Other 4671heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Other 4686heterozygoteVUS3- Undef
CF-causing- Undef
Other 4690heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4698heterozygoteCF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
Other 4705heterozygoteCF-causing- Undef
CF-causing- Undef
Other 4714heterozygoteCF-causing- Undef
Other 4836heterozygoteCF-causing- Undef
VUS3- Undef
Other 87heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 186heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 358heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 464heterozygoteVUS3- Undef
CF-causing- Undef
Other 756heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 757heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 779heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 845heterozygoteCF-causing- Undef
Other 937heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 972heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Other 980heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
varying clinical consequence- Undef
Other 5518heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4770heterozygoteCF-causing- Undef
VUS1- Undef
Other 4774heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4777heterozygoteCF-causing- Undef
VUS3- Undef
Other 4799heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Other 4800heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
Other 1061heterozygoteVUS2- Undef
Other 5184heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
Other 1069heterozygoteCF-causing- Undef
VUS5- Undef
Other 1082heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 1098heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 1099heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 1113heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS1- Undef
Other 1136heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 1185heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 1265heterozygoteCF-causing- Undef
Other 1576heterozygoteCF-causing- Undef
VUS1- Undef
Other 2277heterozygoteCF-causing- Undef
Other 2357heterozygoteCF-causing- Undef
Other 2434heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 2448heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 2544heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 5575heterozygoteVUS3- Undef
CF-causing- Undef
Other 4664heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 4762heterozygoteVUS3- Undef
CF-causing- Undef
Other 2934heterozygoteCF-causing- Undef
Other 3076heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Other 3246heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 3247heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 3397heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 5175heterozygoteCF-causing- Undef
VUS3- Undef
Other 5763heterozygoteVUS3- Undef
CF-causing- Undef
VUS1- Undef
Other 5567heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 5775heterozygoteCF-causing- Undef
VUS3- Undef
VUS3- Undef
Other 5163heterozygoteCF-causing- Undef
VUS3- Undef
Other 4278heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS1- Undef
Other 4312heterozygoteCF-causing- Undef
VUS2- Undef
Other 4317heterozygoteCF-causing- Undef
Other 4812heterozygoteCF-causing- Undef
VUS3- Undef
Other 4547heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 4561heterozygoteCF-causing- Undef
VUS4- Undef
Other 4563heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
Other 4567heterozygoteCF-causing- Undef
VUS4- Undef
Other 4570heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Other 4600heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Other 4615heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 627homozygotec.1000C>T - p.(Arg334Trp) - Trans
c.695T>A - p.(Val232Asp) - Trans
Other 940homozygotec.1521_1523del - p.(Phe508del) - Trans
Pending (NBS) 4694heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 4720heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending (NBS) 352heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 387heterozygoteCF-causing- Undef
VUS4- Undef
Pending (NBS) 590heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 646heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 726heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 734heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 775heterozygoteCF-causing- Undef
Pending (NBS) 794heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 799heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5533heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 4769heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 4787heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Pending (NBS) 5183heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
Pending (NBS) 5190heterozygoteCF-causing- Undef
VUS3- Undef
VUS3- Undef
varying clinical consequence- Undef
Pending (NBS) 1076heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5202heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
Pending (NBS) 1180heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 1253heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
Pending (NBS) 1255heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 1312heterozygoteCF-causing- Undef
VUS4- Undef
Pending (NBS) 4852heterozygoteCF-causing- Undef
VUS3- Undef
Pending (NBS) 1522heterozygoteCF-causing- Undef
VUS5- Undef
Pending (NBS) 1530heterozygoteVUS4- Undef
CF-causing- Undef
Pending (NBS) 1547heterozygoteCF-causing - Cis
varying clinical consequence - Trans
Pending (NBS) 2520heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 2940heterozygoteCF-causing- Undef
VUS2- Undef
Pending (NBS) 2964heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5017heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 4643heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 4616heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
Pending (NBS) 4621heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending (NBS) 5313heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 5310heterozygoteCF-causing- Undef
VUS4- Undef
VUS3- Undef
Pending (NBS) 5327heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5566heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
Pending (NBS) 5342heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5609heterozygoteVUS3- Undef
CF-causing- Undef
Pending (NBS) 5615heterozygoteCF-causing- Undef
CF-causing- Undef
Pending (NBS) 5769heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Pending (NBS) 5773heterozygoteCF-causing- Undef
VUS3- Undef
VUS3- Undef
Pending (NBS) 5948heterozygoteCF-causing- Undef
CF-causing- Undef
Pending (NBS) 5951heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5572heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending (NBS) 3540heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
Pending (NBS) 4803heterozygoteCF-causing- Undef
Pending (NBS) 4549heterozygoteCF-causing- Undef
VUS2- Undef
VUS1- Undef
Pending (NBS) 4593heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 4833heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 560heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 899heterozygoteCF-causing- Undef
Bronchiectasis 921heterozygoteCF-causing- Undef
VUS3- Undef
Bronchiectasis 950heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 4773heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS1- Undef
VUS3- Undef
Bronchiectasis 1068heterozygoteCF-causing- Undef
VUS5- Undef
Bronchiectasis 5200heterozygoteCF-causing- Undef
VUS5- Undef
VUS3- Undef
Bronchiectasis 5182heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Bronchiectasis 1090heterozygoteCF-causing- Undef
VUS1- Undef
varying clinical consequence- Undef
Bronchiectasis 1096heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 1117heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4848heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4863heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4866heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 1542heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 2287heterozygoteVUS3- Undef
CF-causing- Undef
Bronchiectasis 2304heterozygoteCF-causing- Undef
Bronchiectasis 2307heterozygoteCF-causing- Undef
Bronchiectasis 2356heterozygoteCF-causing- Undef
VUS1- Undef
Bronchiectasis 2368heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 2409heterozygoteCF-causing- Undef
VUS3- Undef
Bronchiectasis 2415heterozygoteCF-causing- Undef
Bronchiectasis 2420heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 2424heterozygote
Bronchiectasis 2440heterozygoteCF-causing- Undef
Bronchiectasis 2453heterozygoteCF-causing- Undef
Bronchiectasis 2454heterozygoteCF-causing- Undef
Bronchiectasis 2492heterozygoteCF-causing- Undef
Bronchiectasis 2522heterozygoteCF-causing- Undef
VUS1- Undef
Bronchiectasis 2526heterozygoteCF-causing- Undef
VUS1- Undef
Bronchiectasis 2539heterozygoteCF-causing- Undef
Bronchiectasis 2590heterozygoteCF-causing- Undef
VUS4- Undef
Bronchiectasis 3219heterozygoteCFTR-RD-causing- Undef
VUS2- Undef
Bronchiectasis 3269heterozygoteCF-causing- Undef
VUS2- Undef
Bronchiectasis 4623heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 4657heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 5005heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 5618heterozygoteVUS3- Undef
Bronchiectasis 5950heterozygoteCF-causing- Undef
VUS3- Undef
Bronchiectasis 5952heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 5564heterozygoteCF-causing - Cis
VUS4 - Cis
CFTR-RD-causing - Trans
Bronchiectasis 4314heterozygoteCF-causing- Undef
Bronchiectasis 4601heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Bronchiectasis 4604heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 5826homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3718-2477C>T - p.(=) - Trans
Bronchiectasis 5151homozygotec.3415A>G - p.(Ile1139Val) - Trans
c.3824A>T - p.(Asp1275Val) - Trans
Pancreatitis 205heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 669heterozygoteCF-causing- Undef
Pancreatitis 776heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pancreatitis 964heterozygoteCFTR-RD-causing- Undef
VUS4- Undef
Pancreatitis 1063heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pancreatitis 1161heterozygoteCF-causing- Undef
VUS1- Undef
Pancreatitis 2422heterozygote
Pancreatitis 2435heterozygoteCFTR-RD-causing- Undef
Pancreatitis 2473heterozygoteVUS3- Undef
CF-causing- Undef
Pancreatitis 2476heterozygoteCF-causing- Undef
Pancreatitis 2511heterozygoteCF-causing- Undef
Pancreatitis 2528heterozygoteVUS4- Undef
Pancreatitis 2786heterozygoteCF-causing - Cis
CFTR-RD-causing - Trans
Pancreatitis 2907heterozygoteCFTR-RD-causing - Cis
Pancreatitis 3072heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 3245heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pancreatitis 4636heterozygoteCF-causing- Undef
VUS3- Undef
Pancreatitis 4743heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 5007heterozygoteVUS3- Undef
CF-causing- Undef
Pancreatitis 5973heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5974heterozygoteVUS3- Undef
Pancreatitis 5165heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5326heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
varying clinical consequence- Undef
Pancreatitis 5611heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 5949heterozygotevarying clinical consequence- Undef
CF-causing- Undef
VUS3- Undef
VUS1- Undef
Pancreatitis 5569heterozygoteVUS3- Undef
CF-causing- Undef
Pancreatitis 5160heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Pancreatitis 4252heterozygoteVUS1- Undef
Pancreatitis 4273heterozygoteVUS1- Undef
Pancreatitis 4815heterozygoteCF-causing- Undef
CF-causing- Undef
Pancreatitis 4343heterozygoteVUS1- Undef
Pancreatitis 4559heterozygoteCF-causing- Undef
VUS3- Undef
Pending non-CF 753heterozygoteCF-causing- Undef
VUS3- Undef
Pending non-CF 5009heterozygoteVUS3- Undef
CF-causing- Undef
Pending 907heterozygoteCF-causing- Undef
VUS3- Undef
Pending 2944heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending 3073heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pending 4748heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending 5771heterozygoteCF-causing- Undef
CF-causing- Undef
CRS-NP 910heterozygoteCF-causing- Undef
CRS-NP 5531heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CRS-NP 1239heterozygoteCF-causing- Undef
CRS-NP 1554heterozygoteCF-causing- Undef
CRS-NP 3078heterozygoteVUS3- Undef
CF-causing- Undef
CRS-NP 3088heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CRS-NP 4649heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CRS-NP 3161heterozygoteCF-causing- Undef
VUS1- Undef
varying clinical consequence- Undef
CRS-NP 3284heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CRS-NP 4319heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Aquagenic palmoplantar keratoderma 4827heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Aquagenic palmoplantar keratoderma 5149heterozygoteVUS3- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 1290heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 4617heterozygoteCF-causing - Cis
VUS3 - Trans
Asymptomatic compound heterozygote 4641heterozygoteCF-causing- Undef
VUS1- Undef
Asymptomatic compound heterozygote 4763heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5598heterozygoteCF-causing- Undef
VUS3- Undef
Asymptomatic compound heterozygote 5599heterozygoteCF-causing- Undef
VUS1- Undef
Asymptomatic compound heterozygote 5601heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5606heterozygoteVUS3- Undef
VUS1- Undef
CF-causing- Undef
Asymptomatic compound heterozygote 5964heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5164heterozygoteCF-causing- Undef
VUS3- Undef
VUS1- Undef
Asymptomatic compound heterozygote 4579heterozygoteVUS1- Undef
VUS4- Undef
Fetal bowel anomalies 2388heterozygoteCF-causing- Undef
CF-causing- Undef
Fetal bowel anomalies 2535heterozygoteCF-causing- Undef


Color code:   non disease-causing <   VUS1 <   VUS2 <   VUS3 <   VUS4 <   VUS5 <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare