Variant NM_000492.4:c.1680-870T>A


Variant details:
Name NM_000492.4:c.1680-870T>A
Protein name NP_000483.3:p.(=)
Genomic name (hg19) chr7:g.117229537T>A    UCSC    gnomAD
#Exon/intron intron 12
Legacy Name 1811+1650T>A
Class non disease-causing
WT sequence ACTTGAGATATAAGTAAGGTTACTA T CAATCACACCTGAAAAATTTAAATG
Mutant sequence ACTTGAGATATAAGTAAGGTTACTA A CAATCACACCTGAAAAATTTAAATG






External sources:

Not found		dbSNP
rs213965
Not found







112 individuals carrying this variant are reported in CFTR-NGS catalogue


387 patients carrying this variant are reported in CFTR-France:

TOTAL NUMBER OF PATIENTS 387
Asymptomatic compound heterozygote 22
CF 81
CFTR-RD237
  • Aquagenic palmoplantar keratoderma  6
  • Bronchiectasis  24
  • CBAVD  125
  • CRS-NP  5
  • Other  42
  • Pancreatitis  35
Fetal bowel anomalies 2
Pending 4
Pending (NBS) 38
Pending non-CF 3



Detailed genotypes:
Phenotype Patient ID Variant status Additional variants
CF 5168heterozygoteCF-causing- Undef
VUS3- Undef
CF-causing- Undef
VUS3- Undef
CF 5328heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4962heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CF 5215heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CF 884heterozygoteCF-causing- Undef
CF-causing- Undef
CF 926heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 924heterozygoteCF-causing- Undef
CF-causing- Undef
CF 913heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 5006heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5016heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 3282heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4764heterozygoteCF-causing- Undef
CF-causing- Undef
CF 2893heterozygoteCF-causing- Undef
CF-causing- Undef
VUS1- Undef
CF 5256heterozygoteVUS3- Undef
VUS2- Undef
CF-causing- Undef
CF 4791heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 5189heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CF 5186heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CF 5185heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 672heterozygoteCF-causing- Undef
CF-causing- Undef
CF 668heterozygoteCF-causing- Undef
CF-causing- Undef
CF 666heterozygoteCF-causing- Undef
CF-causing- Undef
VUS3- Undef
CF 681heterozygoteCF-causing- Undef
CF-causing- Undef
CF 711heterozygoteCF-causing- Undef
CF-causing- Undef
CF 703heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5767heterozygoteCF-causing- Undef
CF-causing- Undef
CF 696heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CF-causing- Undef
CF 688heterozygoteCF-causing- Undef
CF-causing- Undef
CF 686heterozygoteVUS3- Undef
CF 5963heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4697heterozygoteCF-causing- Undef
CF-causing- Undef
CF 5335heterozygoteCF-causing- Undef
CF-causing- Undef
CF 4732heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CF 4719heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 762heterozygoteCF-causing- Undef
CF-causing- Undef
CF 761heterozygoteCF-causing- Undef
CF-causing- Undef
CF 816heterozygoteCF-causing- Undef
CF-causing- Undef
CF 829heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
CF 787heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CF 733heterozygoteCF-causing- Undef
VUS3- Undef
CF 738heterozygoteCF-causing- Undef
CF-causing- Undef
CF 745heterozygoteCF-causing- Undef
CF-causing- Undef
CF 744heterozygoteVUS3- Undef
CF 3969homozygotec.1521_1523del - p.(Phe508del) - Trans
c.2988+1173_3468+2111del - p.(Leu997_Leu1156del) - Trans
CF 5341homozygotec.2619+106T>A - p.(=) - Trans
c.296C>G - p.(Pro99Arg) - Trans
c.3846G>A - p.(Trp1282*) - Trans
CF 5965homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3718-2477C>T - p.(=) - Trans
CF 5777homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1652G>A - p.(Gly551Asp) - Trans
c.3532_3535dup - p.(Thr1179IlefsTer17) - Trans
CF 4744homozygotec.1521_1523del - p.(Phe508del) - Trans
c.2816A>G - p.(His939Arg) - Trans
CF 4747homozygotec.1521_1523del - p.(Phe508del) - Trans
c.2443del - p.(Glu815Lysfs*6) - Trans
CF 5770homozygotec.1853T>A - p.(Ile618Asn) - Trans
c.3472C>T - p.(Arg1158*) - Trans
CF 5971homozygotec.1624G>T - p.(Gly542*) - Trans
c.3644_3645delinsAT - p.(Leu1215His) - Trans
CF 5174homozygotec.1521_1523del - p.(Phe508del) - Trans
c.870-1113_870-1110del - p.(=) - Trans
CF 5345homozygotec.1521_1523del - p.(Phe508del) - Trans
c.870-1113_870-1110del - p.(=) - Trans
CF 5622homozygotec.1521_1523del - p.(Phe508del) - Trans
c.617T>G - p.(Leu206Trp) - Trans
CF 808homozygotec.3909C>G - p.(Asn1303Lys) - Trans
c.870-1113_870-1110del - p.(=) - Trans
CF 4665homozygotec.1555A>G - p.(Ser519Gly) - Trans
c.1727G>C - p.(Gly576Ala) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
CF 730homozygotec.3131A>G - p.(Glu1044Gly) - Trans
CF 835homozygotec.1521_1523del - p.(Phe508del) - Trans
c.2241_2248del - p.(Ile748Serfs*28) - Trans
CF 909homozygotec.1624G>T - p.(Gly542*) - Trans
c.870-1113_870-1110del - p.(=) - Trans
CF 901homozygotec.2657+5G>A - p.(=) - Trans
CF 882homozygotec.1518C>G - p.(Ile506Met) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CF 863homozygotec.1521_1523del - p.(Phe508del) - Trans
c.1705T>G - p.(Tyr569Asp) - Trans
CF 4718homozygotec.2374C>T - p.(Arg792*) - Trans
c.870-1113_870-1110del - p.(=) - Trans
CF 4688homozygotec.1519_1521del - p.(Ile507del) - Trans
c.2657+5G>A - p.(=) - Trans
CF 316homozygotec.1657C>T - p.(Arg553*) - Trans
c.870-1113_870-1110del - p.(=) - Trans
CF 716homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3705T>G - p.(Ser1235Arg) - Trans
c.3822G>A - p.(Trp1274*) - Trans
CF 691homozygotec.148T>C - p.(Ser50Pro) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CF 663homozygotec.1399C>T - p.(Leu467Phe) - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.870-1113_870-1110del - p.(=) - Trans
CF 5067homozygotec.1521_1523del - p.(Phe508del) - Trans
c.2619+106T>A - p.(=) - Trans
c.3874-4522A>G - p.(=) - Trans
CF 1140homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3964-78_4242+577del - p.(Gly1323_Val1415del) - Trans
CF 5188homozygotec.1792A>T - p.(Lys598*) - Trans
CF 4796homozygotec.*133T>A - p.(=) - Trans
c.1624G>T - p.(Gly542*) - Trans
c.54-589A>G - p.(=) - Trans
c.870-1113_870-1110del - p.(=) - Trans
CF 4629homozygotec.137C>A - p.(Ala46Asp) - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.580-92T>A - p.(=) - Trans
CF 3275homozygotec.1521_1523del - p.(Phe508del) - Trans
c.1647T>G - p.(Ser549Arg) - Trans
c.4137-136A>G - p.(=) - Trans
CF 5807homozygotec.1475C>T - p.(Ser492Phe) - Trans
c.222_223delinsA - p.(Arg75AspfsTer16) - Trans
CF 977homozygotec.680T>G - p.(Leu227Arg) - Trans
CF 975homozygotec.1624G>T - p.(Gly542*) - Trans
c.91C>T - p.(Arg31Cys) - Trans
CF 947homozygotec.1521_1523del - p.(Phe508del) - Trans
c.870-1113_870-1110del - p.(=) - Trans
CF 945homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3617C>A - p.(Ser1206*) - Trans
CF 943homozygotec.1040G>A - p.(Arg347His) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CF 930homozygotec.3909C>G - p.(Asn1303Lys) - Trans
CF 920homozygotec.1399C>T - p.(Leu467Phe) - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.3160C>G - p.(His1054Asp) - Trans
Other 937heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 980heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
varying clinical consequence- Undef
Other 5743heterozygoteCF-causing- Undef
VUS1- Undef
CFTR-RD-causing- Undef
Other 5087heterozygoteVUS3- Undef
VUS3- Undef
Other 4826heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Other 935heterozygoteCFTR-RD-causing- Undef
Other 4762heterozygoteVUS3- Undef
CF-causing- Undef
Other 4664heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 3046heterozygoteVUS1- Undef
VUS4- Undef
Other 5518heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4799heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Other 5201heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 5187heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 5184heterozygoteVUS3- Undef
CF-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
Other 5763heterozygoteVUS3- Undef
CF-causing- Undef
VUS1- Undef
Other 4705heterozygoteCF-causing- Undef
CF-causing- Undef
Other 779heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4695heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 4690heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 5163heterozygoteCF-causing- Undef
VUS3- Undef
Other 4836heterozygoteCF-causing- Undef
VUS3- Undef
Other 4835heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Other 4846heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 4714heterozygoteCF-causing- Undef
Other 4686heterozygoteVUS3- Undef
CF-causing- Undef
Other 756heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Other 789heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Other 845heterozygoteCF-causing- Undef
Other 5616heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Other 757heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Other 5967homozygotec.2780T>C - p.(Leu927Pro) - Trans
c.870-1113_870-1110del - p.(=) - Trans
Other 5175homozygotec.1521_1523del - p.(Phe508del) - Trans
c.1630G>A - p.(Gly544Ser) - Trans
Other 4698homozygotec.1521_1523del - p.(Phe508del) - Trans
c.2619+106T>A - p.(=) - Trans
c.2909-15T>G - p.(=) - Trans
Other 5083homozygotec.1327G>T - p.(Asp443Tyr) - Trans
c.1727G>C - p.(Gly576Ala) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
c.3909C>G - p.(Asn1303Lys) - Trans
Other 4671homozygotec.1585-9449C>A - p.(=) - Trans
c.1727G>C - p.(Gly576Ala) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
Other 4800homozygotec.*1251C>T - p.(=) - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.54-589A>G - p.(=) - Trans
c.617T>G - p.(Leu206Trp) - Trans
Other 4760homozygotec.1163C>T - p.(Thr388Met) - Trans
Other 4625homozygotec.2619+106T>A - p.(=) - Trans
c.721G>T - p.(Gly241Trp) - Trans
Other 5825homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.1680-871A>G - p.(=) - Trans
Other 972homozygotec.1521_1523del - p.(Phe508del) - Trans
c.1727G>C - p.(Gly576Ala) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
Other 940homozygotec.1521_1523del - p.(Phe508del) - Trans
Other 5224homozygotec.-274C>A - p.(=) - Trans
c.1210-34_1210-6TG[11]T[5] - Trans
CBAVD 941heterozygoteVUS4- Undef
CF-causing- Undef
CBAVD 938heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 986heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 5809heterozygoteVUS4- Undef
VUS3- Undef
CBAVD 5223heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 931heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 897heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 895heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 894heterozygotevarying clinical consequence- Undef
VUS3- Undef
CBAVD 892heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 891heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 887heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 876heterozygoteCF-causing- Undef
VUS4- Undef
CBAVD 875heterozygoteCF-causing- Undef
VUS4- Undef
CBAVD 873heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 5764heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 927heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS4- Undef
CBAVD 918heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 859heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 5022heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
VUS3- Undef
varying clinical consequence- Undef
CBAVD 5015heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4755heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 4754heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4753heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4750heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4651heterozygoteVUS3- Undef
CF-causing- Undef
VUS1- Undef
CBAVD 4650heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4624heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5590heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5591heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 5821heterozygoteCF-causing- Undef
varying clinical consequence- Undef
CBAVD 5968heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5969heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 4653heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 5234heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 5181heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
CBAVD 5228heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CBAVD 676heterozygoteVUS3- Undef
CBAVD 5134heterozygoteVUS3- Undef
CF-causing- Undef
CBAVD 665heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 664heterozygote
CBAVD 5072heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 678heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 679heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 712heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 5768heterozygoteCF-causing- Undef
VUS3- Undef
CBAVD 690heterozygote
CBAVD 687heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 4837heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 4699heterozygoteCFTR-RD-causing- Undef
VUS2- Undef
CF-causing- Undef
CBAVD 4682heterozygoteCF-causing- Undef
VUS1- Undef
CFTR-RD-causing- Undef
CBAVD 4707heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CBAVD 4710heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CF-causing- Undef
CBAVD 4740heterozygoteCF-causing- Undef
VUS1- Undef
CBAVD 4735heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
varying clinical consequence- Undef
CBAVD 806heterozygoteVUS3- Undef
CBAVD 774heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 805heterozygoteVUS1- Undef
CBAVD 5765heterozygotevarying clinical consequence- Undef
CF-causing- Undef
VUS3- Undef
CBAVD 818heterozygote
CBAVD 810heterozygoteVUS2- Undef
CF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 812heterozygoteVUS5- Undef
CF-causing- Undef
CBAVD 792heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 849heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 858heterozygote
CBAVD 856heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 735heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 736heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CBAVD 841heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 751heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CBAVD 746heterozygoteCFTR-RD-causing- Undef
CBAVD 743heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
CBAVD 5600homozygotec.2735C>G - p.(Ser912Trp) - Trans
CBAVD 5603homozygotec.1521_1523del - p.(Phe508del) - Trans
c.509G>A - p.(Arg170His) - Trans
CBAVD 5325homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.2619+106T>A - p.(=) - Trans
c.769G>T - p.(Glu257*) - Trans
CBAVD 5314homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.2195T>G - p.(Leu732*) - Trans
CBAVD 5944homozygotec.1521_1523del - p.(Phe508del) - Trans
c.2813T>G - p.(Val938Gly) - Trans
CBAVD 5947homozygotec.1327G>T - p.(Asp443Tyr) - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.1727G>C - p.(Gly576Ala) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
CBAVD 5946homozygotec.1521_1523del - p.(Phe508del) - Trans
c.4186A>C - p.(Thr1396Pro) - Trans
CBAVD 5945homozygotec.1657C>T - p.(Arg553*) - Trans
c.2619+106T>A - p.(=) - Trans
c.350G>A - p.(Arg117His) - Trans
CBAVD 5766homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.2619+106T>A - p.(=) - Trans
c.350G>A - p.(Arg117His) - Trans
CBAVD 5592homozygotec.1210-34_1210-6TG[12]T[5] - Trans
c.233dup - p.(Trp79Leufs*32) - Trans
CBAVD 5346homozygotec.1521_1523del - p.(Phe508del) - Trans
c.2813T>G - p.(Val938Gly) - Trans
CBAVD 5173homozygotec.1521_1523del - p.(Phe508del) - Trans
c.166G>A - p.(Glu56Lys) - Trans
c.3080T>C - p.(Ile1027Thr) - Trans
CBAVD 5344homozygotec.1364C>A - p.(Ala455Glu) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CBAVD 912homozygotec.1521_1523del - p.(Phe508del) - Trans
c.617T>G - p.(Leu206Trp) - Trans
CBAVD 834homozygotec.1521_1523del - p.(Phe508del) - Trans
c.617T>G - p.(Leu206Trp) - Trans
CBAVD 786homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.1521_1523del - p.(Phe508del) - Trans
CBAVD 765homozygotec.1521_1523del - p.(Phe508del) - Trans
c.617T>G - p.(Leu206Trp) - Trans
CBAVD 763homozygotec.1327G>T - p.(Asp443Tyr) - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.1727G>C - p.(Gly576Ala) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
CBAVD 728homozygotec.1521_1523del - p.(Phe508del) - Trans
c.350G>A - p.(Arg117His) - Trans
CBAVD 837homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.1521_1523del - p.(Phe508del) - Trans
CBAVD 838homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3415A>G - p.(Ile1139Val) - Trans
CBAVD 908homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1466C>T - p.(Ser489Leu) - Trans
c.1684G>A - p.(Val562Ile) - Trans
CBAVD 900homozygotec.1327G>T - p.(Asp443Tyr) - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.1727G>C - p.(Gly576Ala) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
CBAVD 893homozygotec.1521_1523del - p.(Phe508del) - Trans
c.350G>A - p.(Arg117His) - Trans
CBAVD 881homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.617T>G - p.(Leu206Trp) - Trans
CBAVD 868homozygotec.1521_1523del - p.(Phe508del) - Trans
c.4225G>A - p.(Glu1409Lys) - Trans
CBAVD 857homozygotec.1521_1523del - p.(Phe508del) - Trans
c.617T>G - p.(Leu206Trp) - Trans
CBAVD 840homozygotec.1521_1523del - p.(Phe508del) - Trans
c.617T>G - p.(Leu206Trp) - Trans
CBAVD 725homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
c.3846G>A - p.(Trp1282*) - Trans
CBAVD 4729homozygotec.3160C>T - p.(His1054Tyr) - Trans
c.3170C>G - p.(Thr1057Arg) - Trans
CBAVD 4706homozygotec.1652G>A - p.(Gly551Asp) - Trans
c.2939T>A - p.(Ile980Lys) - Trans
CBAVD 4683homozygotec.1327G>T - p.(Asp443Tyr) - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.1727G>C - p.(Gly576Ala) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
CBAVD 4679homozygotec.1521_1523del - p.(Phe508del) - Trans
c.617T>G - p.(Leu206Trp) - Trans
CBAVD 724homozygotec.1521_1523del - p.(Phe508del) - Trans
c.350G>A - p.(Arg117His) - Trans
CBAVD 721homozygotec.1521_1523del - p.(Phe508del) - Trans
c.350G>A - p.(Arg117His) - Trans
CBAVD 720homozygotec.4097T>C - p.(Ile1366Thr) - Trans
CBAVD 717homozygotec.1521_1523del - p.(Phe508del) - Trans
c.350G>A - p.(Arg117His) - Trans
CBAVD 710homozygotec.1521_1523del - p.(Phe508del) - Trans
c.4276T>C - p.(Ser1426Pro) - Trans
CBAVD 701homozygotec.350G>A - p.(Arg117His) - Trans
CBAVD 682homozygotec.1327G>T - p.(Asp443Tyr) - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.1727G>C - p.(Gly576Ala) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
CBAVD 919homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
c.3846G>A - p.(Trp1282*) - Trans
CBAVD 4756homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3908A>T - p.(Asn1303Ile) - Trans
CBAVD 4663homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.2619+106T>A - p.(=) - Trans
c.262_263del - p.(Leu88Ilefs*22) - Trans
CBAVD 4622homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.1521_1523del - p.(Phe508del) - Trans
CBAVD 4646homozygotec.1327G>T - p.(Asp443Tyr) - Trans
c.1727G>C - p.(Gly576Ala) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
c.680T>G - p.(Leu227Arg) - Trans
CBAVD 4761homozygotec.1521_1523del - p.(Phe508del) - Trans
c.349C>T - p.(Arg117Cys) - Trans
CBAVD 4752homozygotec.1327G>T - p.(Asp443Tyr) - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.1727G>C - p.(Gly576Ala) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
CBAVD 3267homozygotec.-34C>T - p.(=) - Trans
c.1521_1523del - p.(Phe508del) - Trans
CBAVD 5068homozygotec.1521_1523del - p.(Phe508del) - Trans
c.2619+106T>A - p.(=) - Trans
c.3874-4522A>G - p.(=) - Trans
CBAVD 978homozygotec.1521_1523del - p.(Phe508del) - Trans
c.617T>G - p.(Leu206Trp) - Trans
CBAVD 949homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1521_1523del - p.(Phe508del) - Trans
CBAVD 5229homozygotec.1585-1G>A - p.(=) - Trans
c.2939T>A - p.(Ile980Lys) - Trans
CBAVD 675homozygotec.1521_1523del - p.(Phe508del) - Trans
c.350G>A - p.(Arg117His) - Trans
Pancreatitis 5155heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
VUS3- Undef
Pancreatitis 964heterozygoteCFTR-RD-causing- Undef
VUS4- Undef
Pancreatitis 5326heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
varying clinical consequence- Undef
Pancreatitis 5145heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 5171heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5329heterozygoteVUS4- Undef
varying clinical consequence- Undef
Pancreatitis 5340heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 5339heterozygotevarying clinical consequence- Undef
VUS3- Undef
CFTR-RD-causing- Undef
Pancreatitis 5336heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5007heterozygoteVUS3- Undef
CF-causing- Undef
Pancreatitis 4642heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 4639heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 4636heterozygoteCF-causing- Undef
VUS3- Undef
Pancreatitis 4659heterozygoteVUS3- Undef
Pancreatitis 5010heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pancreatitis 5973heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5977heterozygoteVUS3- Undef
Pancreatitis 5621heterozygoteCFTR-RD-causing- Undef
Pancreatitis 669heterozygoteCF-causing- Undef
Pancreatitis 5070heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 4692heterozygotevarying clinical consequence- Undef
CFTR-RD-causing- Undef
Pancreatitis 4708heterozygoteVUS3- Undef
VUS3- Undef
Pancreatitis 5614heterozygoteVUS3- Undef
Pancreatitis 776heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pancreatitis 5608heterozygoteVUS3- Undef
Pancreatitis 5605heterozygoteVUS2- Undef
Pancreatitis 5611heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
Pancreatitis 5619heterozygoteVUS3- Undef
Pancreatitis 4743homozygotec.1521_1523del - p.(Phe508del) - Trans
c.350G>A - p.(Arg117His) - Trans
Pancreatitis 5364homozygotec.2619+106T>A - p.(=) - Trans
c.3340G>C - p.(Val1114Leu) - Trans
Pancreatitis 5154homozygotec.2619+106T>A - p.(=) - Trans
c.350G>A - p.(Arg117His) - Trans
c.509G>A - p.(Arg170His) - Trans
Pancreatitis 5332homozygotec.2619+106T>A - p.(=) - Trans
Pancreatitis 5165homozygotec.2502T>G - p.(Phe834Leu) - Trans
c.3718-79T>C - p.(=) - Trans
Pancreatitis 5949homozygotec.1210-34_1210-6TG[13]T[5] - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.2619+106T>A - p.(=) - Trans
c.3705T>G - p.(Ser1235Arg) - Trans
Pancreatitis 3253homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3205G>A - p.(Gly1069Arg) - Trans
Pending (NBS) 5313heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 5310heterozygoteCF-causing- Undef
VUS4- Undef
VUS3- Undef
Pending (NBS) 951heterozygoteVUS2- Undef
CF-causing- Undef
VUS4- Undef
Pending (NBS) 5327heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 5089heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 991heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
CFTR-RD-causing- Undef
Pending (NBS) 5342heterozygoteCF-causing- Undef
varying clinical consequence- Undef
Pending (NBS) 4631heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 4621heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending (NBS) 4787heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Pending (NBS) 5816heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending (NBS) 5183heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
Pending (NBS) 5773heterozygoteCF-causing- Undef
VUS3- Undef
VUS3- Undef
Pending (NBS) 5769heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Pending (NBS) 4720heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Pending (NBS) 775heterozygoteCF-causing- Undef
Pending (NBS) 5615heterozygoteCF-causing- Undef
CF-causing- Undef
Pending (NBS) 803heterozygoteVUS2- Undef
CF-causing- Undef
Pending (NBS) 734heterozygotevarying clinical consequence- Undef
CF-causing- Undef
Pending (NBS) 4644homozygotec.1209G>C - p.(Glu403Asp) - Trans
c.2657+5G>A - p.(=) - Trans
Pending (NBS) 4645homozygotec.1000C>T - p.(Arg334Trp) - Trans
c.2619+106T>A - p.(=) - Trans
c.490A>C - p.(Thr164Pro) - Trans
Pending (NBS) 5951homozygotec.1521_1523del - p.(Phe508del) - Trans
c.870-1113_870-1110del - p.(=) - Trans
Pending (NBS) 5948homozygotec.1521_1523del - p.(Phe508del) - Trans
c.171G>A - p.(Trp57*) - Trans
Pending (NBS) 799homozygotec.3909C>G - p.(Asn1303Lys) - Trans
c.617T>G - p.(Leu206Trp) - Trans
Pending (NBS) 794homozygotec.1521_1523del - p.(Phe508del) - Trans
c.617T>G - p.(Leu206Trp) - Trans
Pending (NBS) 726homozygotec.1521_1523del - p.(Phe508del) - Trans
c.1801A>T - p.(Ile601Phe) - Trans
Pending (NBS) 5071homozygotec.-288G>C - p.(=) - Trans
c.2657+5G>A - p.(=) - Trans
c.3139+89T>C - p.(=) - Trans
Pending (NBS) 4694homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3154T>G - p.(Phe1052Val) - Trans
Pending (NBS) 4654homozygotec.1521_1523del - p.(Phe508del) - Trans
c.617T>G - p.(Leu206Trp) - Trans
Pending (NBS) 5202homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3095A>G - p.(Tyr1032Cys) - Trans
c.54-589A>G - p.(=) - Trans
Pending (NBS) 5190homozygotec.1521_1523del - p.(Phe508del) - Trans
c.357C>T - p.(=) - Trans
c.54-589A>G - p.(=) - Trans
c.617T>G - p.(Leu206Trp) - Trans
Pending (NBS) 4616homozygotec.1521_1523del - p.(Phe508del) - Trans
c.350G>A - p.(Arg117His) - Trans
Pending (NBS) 4643homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3458T>A - p.(Val1153Glu) - Trans
Pending (NBS) 5017homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3908A>T - p.(Asn1303Ile) - Trans
Pending (NBS) 5817homozygotec.1013C>T - p.(Thr338Ile) - Trans
c.1521_1523del - p.(Phe508del) - Trans
Pending (NBS) 5808homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3874-1_3874delinsAG - p.(?) - Trans
Pending (NBS) 5820homozygotec.1624G>T - p.(Gly542*) - Trans
c.2989-357C>T - p.(?) - Trans
c.3908A>T - p.(Asn1303Ile) - Trans
Pending (NBS) 5247homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1364C>T - p.(Ala455Val) - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.53+4A>T - p.(=) - Trans
Bronchiectasis 4726heterozygoteCFTR-RD-causing- Undef
varying clinical consequence- Undef
Bronchiectasis 899heterozygoteCF-causing- Undef
Bronchiectasis 921heterozygoteCF-causing- Undef
VUS3- Undef
Bronchiectasis 950heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 966heterozygoteVUS4- Undef
VUS4- Undef
Bronchiectasis 5530heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Bronchiectasis 5200heterozygoteCF-causing- Undef
VUS5- Undef
VUS3- Undef
Bronchiectasis 5182heterozygoteCF-causing- Undef
varying clinical consequence- Undef
VUS3- Undef
Bronchiectasis 3269heterozygoteCF-causing- Undef
VUS2- Undef
Bronchiectasis 5331heterozygoteVUS5- Undef
Bronchiectasis 5618heterozygoteVUS3- Undef
Bronchiectasis 5624heterozygoteVUS3- Undef
CF-causing- Undef
Bronchiectasis 5950heterozygoteCF-causing- Undef
VUS3- Undef
Bronchiectasis 5952heterozygoteCFTR-RD-causing- Undef
CF-causing- Undef
Bronchiectasis 4725homozygotec.1521_1523del - p.(Phe508del) - Trans
c.1704G>T - p.(Leu568Phe) - Trans
Bronchiectasis 5074homozygotec.1210-34_1210-6TG[11]T[5] - Trans
Bronchiectasis 693homozygotec.137C>A - p.(Ala46Asp) - Trans
c.350G>A - p.(Arg117His) - Trans
c.580-92T>A - p.(=) - Trans
Bronchiectasis 777homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
Bronchiectasis 5826homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3718-2477C>T - p.(=) - Trans
Bronchiectasis 4623homozygotec.1521_1523del - p.(Phe508del) - Trans
c.349C>T - p.(Arg117Cys) - Trans
Bronchiectasis 4657homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3140-26A>G - p.(=) - Trans
Bronchiectasis 5005homozygotec.1521_1523del - p.(Phe508del) - Trans
c.350G>A - p.(Arg117His) - Trans
Bronchiectasis 5972homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.870-1113_870-1110del - p.(=) - Trans
Bronchiectasis 5151homozygotec.3415A>G - p.(Ile1139Val) - Trans
c.3824A>T - p.(Asp1275Val) - Trans
Fetal bowel anomalies 4738heterozygoteVUS3- Undef
Fetal bowel anomalies 5604heterozygoteVUS3- Undef
Asymptomatic compound heterozygote 922heterozygoteVUS4- Undef
Asymptomatic compound heterozygote 4628heterozygoteVUS3- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 4617heterozygoteCF-causing - Cis
VUS3 - Trans
Asymptomatic compound heterozygote 4641heterozygoteCF-causing- Undef
VUS1- Undef
Asymptomatic compound heterozygote 4656heterozygoteVUS3- Undef
VUS2- Undef
VUS3- Undef
VUS3- Undef
Asymptomatic compound heterozygote 5167heterozygoteVUS1- Undef
varying clinical consequence- Undef
Asymptomatic compound heterozygote 5333heterozygoteVUS5- Undef
CFTR-RD-causing- Undef
Asymptomatic compound heterozygote 5599heterozygoteCF-causing- Undef
VUS1- Undef
Asymptomatic compound heterozygote 5602heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
VUS3- Undef
Asymptomatic compound heterozygote 5164heterozygoteCF-causing- Undef
VUS3- Undef
VUS1- Undef
Asymptomatic compound heterozygote 5077homozygotec.164+28A>G - p.(=) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
Asymptomatic compound heterozygote 5141homozygotec.1727G>C - p.(Gly576Ala) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
c.2756A>G - p.(Tyr919Cys) - Trans
Asymptomatic compound heterozygote 5140homozygotec.1118A>G - p.(Asp373Gly) - Trans
c.1521_1523del - p.(Phe508del) - Trans
Asymptomatic compound heterozygote 5177homozygotec.2756A>G - p.(Tyr919Cys) - Trans
Asymptomatic compound heterozygote 5218homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.2758G>T - p.(Val920Leu) - Trans
c.3409A>G - p.(Met1137Val) - Trans
Asymptomatic compound heterozygote 5525homozygotec.4275T>A - p.(Asp1425Glu) - Trans
c.91C>T - p.(Arg31Cys) - Trans
Asymptomatic compound heterozygote 5818homozygotec.1052C>G - p.(Thr351Ser) - Trans
c.1210-34_1210-6TG[11]T[5] - Trans
Asymptomatic compound heterozygote 4763homozygotec.1521_1523del - p.(Phe508del) - Trans
c.3154T>G - p.(Phe1052Val) - Trans
Asymptomatic compound heterozygote 5598homozygotec.1521_1523del - p.(Phe508del) - Trans
c.964G>A - p.(Val322Met) - Trans
Asymptomatic compound heterozygote 5601homozygotec.1521_1523del - p.(Phe508del) - Trans
c.1727G>C - p.(Gly576Ala) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
Asymptomatic compound heterozygote 5606homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1684G>A - p.(Val562Ile) - Trans
c.3909C>G - p.(Asn1303Lys) - Trans
Asymptomatic compound heterozygote 5964homozygotec.1327G>T - p.(Asp443Tyr) - Trans
c.1521_1523del - p.(Phe508del) - Trans
c.1727G>C - p.(Gly576Ala) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
Pending non-CF 753heterozygoteCF-causing- Undef
VUS3- Undef
Pending non-CF 4825heterozygoteCFTR-RD-causing- Undef
CFTR-RD-causing- Undef
CFTR-RD-causing- Undef
varying clinical consequence- Undef
Pending non-CF 5009homozygotec.*2G>C - p.(=) - Trans
c.1521_1523del - p.(Phe508del) - Trans
Pending 907heterozygoteCF-causing- Undef
VUS3- Undef
Pending 4748heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Pending 5771heterozygoteCF-causing- Undef
CF-causing- Undef
Pending 5008homozygotec.2657+5G>A - p.(=) - Trans
c.2988+1G>A - p.(=) - Trans
CRS-NP 910heterozygoteCF-causing- Undef
CRS-NP 3284heterozygotevarying clinical consequence- Undef
CF-causing- Undef
CRS-NP 5338heterozygoteCFTR-RD-causing- Undef
VUS3- Undef
CRS-NP 5138homozygotec.3154T>G - p.(Phe1052Val) - Trans
c.3409A>G - p.(Met1137Val) - Trans
CRS-NP 4649homozygotec.1521_1523del - p.(Phe508del) - Trans
c.870-1113_870-1110del - p.(=) - Trans
Aquagenic palmoplantar keratoderma 4827heterozygoteCF-causing- Undef
CFTR-RD-causing- Undef
Aquagenic palmoplantar keratoderma 5822heterozygoteVUS3- Undef
VUS1- Undef
Aquagenic palmoplantar keratoderma 5613heterozygoteVUS5- Undef
Aquagenic palmoplantar keratoderma 4660homozygotec.1727G>C - p.(Gly576Ala) - Trans
c.2002C>T - p.(Arg668Cys) - Trans
c.2657+5G>A - p.(=) - Trans
Aquagenic palmoplantar keratoderma 5149homozygotec.1210-34_1210-6TG[11]T[5] - Trans
c.1521_1523del - p.(Phe508del) - Trans
Aquagenic palmoplantar keratoderma 5772homozygotec.4139C>T - p.(Thr1380Ile) - Trans


Color code:   non disease-causing <   VUS1 <   VUS2 <   VUS3 <   VUS4 <   VUS5 <   disease-causing



            CFTR variants are clustered into five groups:
  • CF-causing: when in trans with another CF-causing mutation, will result in CF.
  • CFTR-RD causing: when in trans with a CF-causing mutation, will result in CFTR-related disorders (CFTR-RD) such as chronic pancreatitis, bronchiectasis, CRS-NP (chronic rhinosinusitis with or without nasal polyposis) or CBAVD (congenital absence of vas deferens), according to Bombieri C et al., 2011.
  • Varying clinical consequence: when in trans with another CF-causing mutation, can either result in CF or in a CFTR-RD.
  • Non disease-causing: when in trans with a CF-causing mutation, will not cause CF, nor CFTR-RD.
  • VUS (Variant of unknown clinical significance): unclassified because of insufficient data.



Go to CFTRare